Hylotelephium spectabile

(Boreau) H.Ohba · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Hylotelephium

At a glance

Occurrence records3 083

Data sources11

Biological traits23

DNA specimens5

eDNA detections4

Sources11 archives

Databases and archives Hylotelephium spectabile's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 083 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF3 083 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB1.8 Gbp

01Narrative

Hylotelephium spectabile (syn. Sedum spectabile) is a species of flowering plant in the stonecrop family Crassulaceae, native to China and Korea. Its common names include showy stonecrop, iceplant, and butterfly stonecrop.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Leaf length max90 mm

Leaf width70 mm

Leaf width max70 mm

Leaf width min70 mm

Plant height0.7 m

Plant height max0.5 m

Plant height min0.3 m

Seed length1 mm

Seed length max1 mm

Seed length min1 mm

Life cycle & reproduction4

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Flowering startDec

Life formsucculent perennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCoastal

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3-CAM

⚠ sources differ — TRY: C3/CAM · GIFT: C3

03Chemical composition2 compounds

Compounds documented for Hylotelephium spectabile across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Monosaccharides2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
D-glycero-D-manno-2-Octulose		present	LOTUS
D-manno-2-heptulose		present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hylotelephium spectabile has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences7

eDNA detections4

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPZ213447.1 ↗621 bpIndia · 2025

ACGT

CTGCGGAAGGATCATTGTCGAATCCTAGAAAGCACGACCGAGGACAAGTAAATTAATTGGGTAAGCGTCGGGTTGCCCTTTGGGCATCTC …

Hylotelephium spectabile voucher PUN 640242 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hylotelephium spectabile carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 819 080 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Hylotelephium spectabile1.82 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 501×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Baldwin 1937

2n 511×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Soeda 1944

n 251×CCDB · book-ipcn72

CCDB · book-ipcn72 — CHARLES, H.U., & R. MORAN. 1972. Chromosomes of Crassulaceae from Japan and south Korea. Cytologia 37: 59-81.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 083 records

Wild obs. + sensor2 906

Museum / vouchered162

Cultivated / captive9

Other6

Origin

Introduced736

Range

Area of Occupancy AOO8 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 691≤1 km 420≤10 km 1 525>10 km 17

2 653 georeferenced · 253 without coordinates

Open the mapobservation + sensor2 906

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 31≤1 km 5≤10 km 7

43 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence162

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤1 km 4≤10 km 2

6 georeferenced · 3 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Applied Ecology, Academia Sinicalocation not on record	27
SLU Artdatabankenlocation not on record	20
Beijing, CN	18
Moscow State Universitylocation not on record	8
Kyoto Universitylocation not on record	7
Olocation not on record	6
LDlocation not on record	6
Auckland, NZ	6
Oskarshamn, SE	6
KR	5
University of Stellenboschlocation not on record	5
Herbarium of the Department of Botany, University of Tokyolocation not on record	5
National Institute of Biological Resourceslocation not on record	4
Mlocation not on record	3
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	2
Yangling, CN	2
Trondheim, NO	2
Jiangxi College of Educationlocation not on record	2
BRNUlocation not on record	2
Provincia di Livornolocation not on record	2
Universidad Católica de Santa Maríalocation not on record	2
Saint Louis, US	1
Denver, US	1
Görlitz, DE	1
TROMlocation not on record	1
Vancouver, CA	1
PrivatHerblocation not on record	1
BIO-UNIPIlocation not on record	1
KNAMlocation not on record	1
DBF-NHMDlocation not on record	1
BSBIlocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
ifplocation not on record	1
Bangkok, TH	1

35 institutions · 156 of 162 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Hylotelephium spectabile was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.30 °C -0.5–13.1

Seasonal swing summer↔winter29.0 °C

Max temp (day)10.1 °C 3.40–16.8

Min temp (night)2.30 °C -5.10–9.80

Precipitation58.7 mm/mo 41.0–76.5

Air humidity61.6 % 60.7–62.5

Moisture balance-1.80 mm/mo -8.50–4.80

Vapour deficit498 Pa 391–605

Wind speed3.10 m/s 2.30–3.80

Cloud cover50.7 % 44.4–56.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hylotelephium spectabile

At a glance

Sources11 archives

Size & morphology10

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Compound class profile1 class

Documented compounds2 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 083 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 083 records