Hylotelephium sieboldii

(Regel) H.Ohba · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Hylotelephium

At a glance

Occurrence records39

Data sources10

Biological traits5

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Hylotelephium sieboldii's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility39 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF39 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 50

01Narrative

Hylotelephium sieboldii (syn. Sedum sieboldii), the October stonecrop, Siebold's stonecrop, Siebold's sedum or October daphne, is a species of flowering plant in the family Crassulaceae, native to Japan. Growing to 10 cm high by 20 cm wide, this trailing deciduous perennial produces its round glaucous leaves in whorls of 3 around the delicate stems. The hot-pink flowers appear in autumn (fall). The specific epithet sieboldii commemorates Philipp Franz von Siebold, a notable German plant collector of the 19th century. This plant requires some protection from low temperatures in winter, and is often seen in cultivation as a houseplant or in an alpine garden. The cultivar 'Misebaya-nakafu' has variegated green and cream leaves, and has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formsemisucculent perennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hylotelephium sieboldii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAB088567.1 ↗675 bpJapan

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTAGAAAGCACGACCGAGGACATGTAAACTAATTGGGTAAGCGTCGGGCCGCC …

Hylotelephium sieboldii genes for 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, 28S ribosomal RNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hylotelephium sieboldii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidypolyploid inferred

Chromosome records50–522n range50median50mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 503×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Nakata, M., M. Mishima & K. Fukui. 1997. Number of 45S rDNA sites in the two varieties of Hylotelephium sieboldii (Crassulaceae). Bull. Bot. Gard. Toyama 2: 45–50.

CCDB · book-atlas-flowering-plants — Soeda 1944

2n 521×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oginuma, K., R. Tanaka & T. KATAMOTO. 1978. Chromosomes of Sedum sieboldii collected from Shodoshima Is. CIS Chromosome Inform. Serv. 25: 32–33.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type39 records

Wild obs. + sensor25

Museum / vouchered13

Cultivated / captive1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 6≤1 km 1≤10 km 4>10 km 2

13 georeferenced · 12 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2>10 km 2

4 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence13

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yangling, CN	3
Wuhan, CN	2
Beijing, CN	2
Salzburg, AT	1
Tomioka, JP	1
SLU Artdatabankenlocation not on record	1
LDlocation not on record	1
Helsinki, FI	1

8 institutions · 12 of 13 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hylotelephium sieboldii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)