Hylotelephium anacampseros

(L.) H.Ohba · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Hylotelephium

At a glance

Occurrence records6 151

Data sources8

Biological traits10

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Hylotelephium anacampseros's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 151 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF6 151 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Die Rundblättrige Fetthenne (Hylotelephium anacampseros ; Syn.: Sedum anacampseros ) ist eine Pflanzenart aus der Gattung der Hylotelephium, die man früher zur Gattung der Fetthennen (Sedum) gerechnet hat. Rundblättrige Fetthenne (Hylotelephium anacampseros), Illustration

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.2 m

Seed mass0.028 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formsucculent perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment3

Climatetemperate

Growth formherb

⚠ sources differ — GIFT: herb · TRY: succulent

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3-CAM

⚠ sources differ — TRY: C3/CAM · GIFT: C3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hylotelephium anacampseros has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAB088563.1 ↗678 bp

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTAGAAAGCACGACCGAGGACATGTAAATTAATTGGGTAAGTGTCGGGCCGCC …

Hylotelephium anacampseros genes for 18S ribosomal RNA, internal transcribed spacer 1, 5.8S ribosomal RNA, internal transcribed spacer 2, 28S ribosomal RNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hylotelephium anacampseros carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 365×CCDB · ita-fl · CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.

CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Chromosome studies in some flowering plants collected in the French Alps (Hante Savoie). Rev. Gen. Bot. 77: 487-497.

CCDB · book-fedorov — Favarger 1953

CCDB · book-fedorov — D. 1955)

CCDB · book-fedorov — Baldwin 1937

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.928 ↗

08Occurrence & distribution

Record type6 151 records

Wild obs. + sensor6 084

Museum / vouchered65

Cultivated / captive2

Origin

Introduced1

Range

Area of Occupancy AOO4 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 1 376≤1 km 234≤10 km 3 766>10 km 435

5 811 georeferenced · 273 without coordinates

Open the mapobservation + sensor6 084

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 8≤1 km 12≤10 km 5>10 km 2

27 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence65

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	25
Olocation not on record	12
Oskarshamn, SE	4
BFLlocation not on record	3
LDlocation not on record	3
SLU Artdatabankenlocation not on record	3
BRNUlocation not on record	2
Mlocation not on record	2
KMNlocation not on record	2
Sion, CH	1
TROMlocation not on record	1
Edinburgh, GB	1
Trondheim, NO	1
Helsinki, FI	1
Auckland, NZ	1

15 institutions · 62 of 65 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hylotelephium anacampseros

At a glance

Sources8 archives

Size & morphology2

Life cycle & reproduction4

Habitat & environment3

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 151 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 15 geolocated

Cultivated / Captivenot free-living

Record type6 151 records