Hygroryza aristata

(Retz.) Nees ex Wight & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Hygroryza

At a glance

Occurrence records86

Data sources10

Biological traits10

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Hygroryza aristata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT489 Mbp

01Narrative

Hygroryza aristata est une espèce de plantes monocotylédones de la famille des Poaceae, sous-famille des Oryzoideae, originaire d'Asie. C'est l'unique espèce du genre Hygroryza. Ce sont des plantes herbacées vivaces, stolonifères, aquatiques, aux inflorescences en panicules ouvertes, dont les épillets n'ont pas de glumes et ne comptent que des fleurons fertiles. Cette espèce est une mauvaise herbe qui revêt une importance significative dans les rizières. Le nom générique « Hygroryza » est formé de la racine grecque ὑγρός (hygros) qui signifie « humide » et du nom générique oryza qui désigne un genre proche.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Aquatic

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hygroryza aristata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX527478.1 ↗1 250 bp

ACGT

ATTGACTTACTACACCCCGGAGTACGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAGCCGGGGGTTCCGGCCGA …

Hygroryza aristata voucher DZY WQF0676 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hygroryza aristata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size489 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Hygroryza aristata0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–242n range24median24mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2410×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Mini, L. S., J. Christopher & B. Jacob. 1991. Karyomorphological and phylogenetic studies on Hygroryza aristata (Retz.) Nees of the tribe Oryzeae. Cytologia 56: 95–102.

CCDB · book-ipcn67-71 — CHRISTOPHER, J . & A. ABRAHAM. 1971. studies on the cytology and phylogeny of South Indian grasses I. Subfamilies Bambusoideae, Oryzoideae, Arundinoideae and Festucoideae. Cytologia 36: 579-594.

CCDB · book-indian_vol2 — Hirayoshi, I. 1937; Ramanujam, S. 1938 ; Chen, C.C. & Hsu, C.C. 1962; Larsen, K. 1963b; Christo- pher, J. & Abraham, A. 1971

CCDB · book-fedorov — Hirayoshi 1937

CCDB · book-fedorov — Ramanujam 1938

CCDB · book-fedorov — Chen, Hsu 1962

CCDB · book-fedorov — Larsen 1963b

CCDB · book-atlas-flowering-plants — Hirayoshi 1937

CCDB · kew — Baum A, Kenton AY, Bennett MD. (pers. comm. 1989).

n 123×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.

CCDB · ipcn-api-dl — Mini, L. S., J. Christopher & B. Jacob. 1991. Karyomorphological and phylogenetic studies on Hygroryza aristata (Retz.) Nees of the tribe Oryzeae. Cytologia 56: 95–102.

CCDB · book-ipcn75-78 — Kalia 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type86 records

Wild obs. + sensor24

Museum / vouchered53

Cultivated / captive1

Other8

Origin

Native5

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 1>10 km 15

17 georeferenced · 7 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤1 km 17≤10 km 3

20 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence53

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	16
Beijing, CN	8
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	7
TAIElocation not on record	5
Taipei, TW	2
Taipei, TW	2
South Kensington, GB	2
Bronx, US	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Guilin, CN	1
Saint Louis, US	1
Canadian Department of Agriculturelocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Bloomington, US	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Servico de Microbiologia e Imunologialocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1

17 institutions · 52 of 53 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Hygroryza aristata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 24.9–24.9

Seasonal swing summer↔winter11.7 °C

Max temp (day)31.9 °C

Min temp (night)18.6 °C

Precipitation10.1 mm/mo

Air humidity46.2 %

Moisture balance-108 mm/mo

Vapour deficit1,684 Pa

Wind speed2.20 m/s

Cloud cover6.80 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)