Hygrophila polysperma

(Roxb.) T.Anderson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Hygrophila

At a glance

Occurrence records1 006

Data sources13

Biological traits27

DNA specimens4

eDNA detections4

Sources13 archives

Databases and archives Hygrophila polysperma's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 006 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Chemical compositionLOTUS · NPASS62 compounds

Occurrence & distributionGBIF1 006 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Hygrophila polysperma, commonly known as dwarf hygrophila, dwarf hygro, Miramar weed, Indian swampweed or Indian waterweed, is an aquatic plant in the family Acanthaceae. It is native to Bangladesh, India, China and Malaysia, and has also been introduced to the US states of Florida, Texas and possibly Virginia. It is listed on the Federal Noxious Weed List in the US and is illegal to import and sell in a number of states including Kansas and South Carolina.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology9

Fruit length6.5 mm

⚠ sources differ — AusTraits: 6.5 mm · GIFT: 8.5 mm

Fruit length max8.5 mm

Fruit length min8.5 mm

Leaf length4 mm

⚠ sources differ — AusTraits: 4 mm · GIFT: 25 mm

Leaf width1.25 mm

Leaf width max60 mm

Leaf width min20 mm

Plant height0.08 m

Plant height max0.2 m

Life cycle & reproduction5

Dehiscencedehiscent

Life formannual or helophyte

Life spanannual perennial

⚠ sources differ — AusTraits: annual perennial · GIFT: perennial

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max600 m

Elevation mean1 800 m

Elevation min600 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf shapeelliptical oblong

Woodinessnon-woody

03Chemical composition62 compounds

Compounds documented for Hygrophila polysperma across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids9

Eudesmane sesquiterpenoids5

Caryophyllane sesquiterpenoids3

Bisabolane sesquiterpenoids3

Ursane and Taraxastane triterpenoids2

Documented compounds62 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	NPASS
(1R,2E,5R,6E,10S)-3,7-dimethyl-10-propan-2-ylcyclodeca-2,6-diene-1,5-diol	present	NPASS
(1R,2R,3S,6E,8R,10S)-6,10-dimethyl-3-propan-2-yl-11-oxabicyclo[8.1.0]undec-6-ene-2,8-diol	present	NPASS
(1R,2R,4aR,8R,8aS)-2-(2-hydroxypropan-2-yl)-4a-methyl-2,3,4,5,6,7,8,8a-octahydro-1H-naphthalene-1,8-diol	present	NPASS
(1R,4aR,7R,7aR)-7-hydroxy-7-methyl-1-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylic acid	present	LOTUS
(1R,4S,5E,7S)-4-methyl-10-methylidene-7-propan-2-ylcyclodec-5-ene-1,4-diol	present	NPASS
(1R,4S,6R,10S)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane	present	NPASS
(1S,2R,4aR,5R,8aR)-4a-methyl-8-methylidene-2-propan-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol	present	NPASS
(1S,2S,3R,5S,8E,11S)-2-hydroxy-5,9-dimethyl-14-methylidene-4,12-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(1S,2S,3S,5R,8E,11S)-2-hydroxy-5,9-dimethyl-14-methylidene-4,12-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hygrophila polysperma has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP692532.1 ↗613 bp

ACGT

GTAAAAAACCAACACGAGGGCCCCGGCGGGGGGGGCGTATGCTTCCCGTCGTCGGCCCTCCTCCTGCCGGCTTGCCACCAGGCATGCCGT …

Hygrophila polysperma voucher 16562 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hygrophila polysperma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · eflora · CCDB · Cave1956

CCDB · eflora

CCDB · Cave1956 — Grant

n 165×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.

CCDB · ipcn-api-dl — Sarkar, A. K., M. Chakraverty, S. K. DAS, C. R. Pal & D. Hazara. 1980. In Chromosome number reports LXVII. Taxon 29: 358–360.

CCDB · ipcn-api-dl — Sarkar, A. K., M. CHAKRABORTY, N. C. SAHA, S. K. DAS & D. HAZRA. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.

CCDB · ipcn-api-dl — VASUDEVAN, K. N. 1976. Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alps). Part III. Ber. Schweiz. Bot. Ges. 86: 152–203.

CCDB · book-ipcn67-71 — KAUR, J. 1970. Chromosome numbers in Acanthaceae v. Sci. & Cult. 36: 103-10&.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.880 ↗

08Occurrence & distribution

Record type1 006 records

Wild obs. + sensor192

Museum / vouchered138

Cultivated / captive1

Other675

Origin

Introduced3

Range

Area of Occupancy AOO1 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 89≤1 km 11≤10 km 5>10 km 26

131 georeferenced · 61 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 36≤1 km 20≤10 km 2>10 km 2

60 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence138

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	29
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	16
Fort Worth, US	13
Baroda, IN	12
Brisbane, AU	11
Austin, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
MEXUlocation not on record	3
Jena Microbial Resource Collectionlocation not on record	3
Mexico City, MX	3
Adelaide, AU	3
Canadian Department of Agriculturelocation not on record	3
Mount Annan, AU	3
Paris, FR	2
BAYLUlocation not on record	2
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	2
Saint Louis, US	2
Auckland, NZ	1
Columbia, US	1
University of Stellenboschlocation not on record	1
Beijing, CN	1
Kew, GB	1
Guangzhou, CN	1
Tall Timbers Research Stationlocation not on record	1
Taipei, TW	1
Elocation not on record	1
Wellington, NZ	1
Yangling, CN	1
South Kensington, GB	1
Bangkok, TH	1
Jackson, US	1
Taipei, TW	1
Salzburg, AT	1
Tuscaloosa, US	1
Canberra, AU	1
Edinburgh, GB	1

36 institutions · 136 of 138 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Hygrophila polysperma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hygrophila polysperma

At a glance

Sources13 archives

Size & morphology9

Life cycle & reproduction5

Diet & foraging1

Habitat & environment12

Compound class profile5 classes

Documented compounds62 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 006 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 006 records