Hygromia limbata

(Draparnaud, 1805) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Hygromiidae/Hygromia

At a glance

Occurrence records1 398

Data sources9

Biological traits0

DNA specimens77

eDNA detections62

Sources9 archives

Databases and archives Hygromia limbata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 398 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 398 records

Environmental DNA1 datasets · 2 countries62 detections

DNA & barcodingBOLD77 specimens

01Narrative

Hygromia limbata is a species of small air-breathing land snail, a terrestrial pulmonate gastropod mollusk in the family Hygromiidae. MolluscaBase eds. (2021). MolluscaBase. Hygromia limbata (Draparnaud, 1805). Accessed through: World Register of Marine Species at: http://www.marinespecies.org/aphia.php?p=taxdetails&id=1050327 on 2021-03-13 Subspecies : Hygromia limbata limbata (Draparnaud, 1805) Hygromia limbata sublimbata (Bourguignat, 1882)

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hygromia limbata has left across the world's sequence archives.

At a glance

DNA specimens77

BINs7

Marker genes2

eDNA detections62

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P644 bp consensus75 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

3Tmostly conserved

6Tmostly conserved

12Tmostly conserved

16Amostly conserved

21Gmostly conserved

27Amostly conserved

28Cmostly conserved

30Amostly conserved

46Tmostly conserved

54Tmostly conserved

60Amostly conserved

72Tmostly conserved

84Cmostly conserved

99Cmostly conserved

102Amostly conserved

114Amostly conserved

150Tmostly conserved

153Cvariable

159Gmostly conserved

162Tmostly conserved

174Gmostly conserved

175Tmostly conserved

178Tmostly conserved

189Cmostly conserved

192Tmostly conserved

195Cvariable

210Tvariable

213Amostly conserved

225Amostly conserved

231Gmostly conserved

234Amostly conserved

237Gmostly conserved

246Amostly conserved

253Tmostly conserved

264Tmostly conserved

270Amostly conserved

276Cmostly conserved

282Amostly conserved

291Gmostly conserved

294Amostly conserved

297Tmostly conserved

303Gmostly conserved

309Cvariable

312Avariable

321Tmostly conserved

330Amostly conserved

333Tmostly conserved

342Avariable

357Amostly conserved

369Gvariable

384Tmostly conserved

408Tmostly conserved

432Tmostly conserved

441Cmostly conserved

444Tmostly conserved

459Amostly conserved

468Tmostly conserved

477Gmostly conserved

480Gmostly conserved

486Tmostly conserved

490Gmostly conserved

492Tmostly conserved

501Cmostly conserved

504Amostly conserved

505Tmostly conserved

508Cmostly conserved

516Gmostly conserved

525Gmostly conserved

534Avariable

537Tmostly conserved

540Tmostly conserved

543Tmostly conserved

558Tvariable

573Amostly conserved

576Cvariable

585Cmostly conserved

588Gmostly conserved

591Cmostly conserved

597Gmostly conserved

600Amostly conserved

603Tvariable

606Amostly conserved

609Tmostly conserved

618Amostly conserved

621Cmostly conserved

627Tmostly conserved

TGTGGTATAGTTGGAACTGGGTTATCACTATTAATTCGGTTTGAATTAGGTACTTCAGGAGTGTTAAGGGATGATCATTTTTACAATGTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.9%

Haplotypes30

BINs7

Most divergent pair10.9%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Noricella oreinossame family12.4%Ashfordia granulatasame family13.4%Theba grassetisame order13.7%Rossmaessleria scherzerisame order14.5%Rossmaessleria sicanoidessame order14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 398 records

Wild obs. + sensor1 190

Museum / vouchered207

Other1

Range

Area of Occupancy AOO3 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 455≤1 km 59≤10 km 257>10 km 59

830 georeferenced · 360 without coordinates

Open the mapobservation + sensor1 190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 30≤1 km 34≤10 km 63>10 km 14

141 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence207

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Barcelona, ES	80
Paris, FR	12
Adam Mickiewicz University in Poznańlocation not on record	8
Natural History Museum Rotterdamlocation not on record	6
Cambridge, US	5
Brussels, BE	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Delaware Museum of Nature and Sciencelocation not on record	3
RBINS-Scientific Heritagelocation not on record	3
Philadelphia, US	2
Denver, US	1
CBDClocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Paleontological Research Institutionlocation not on record	1
Ann Arbor, US	1

15 institutions · 132 of 207 vouchered records shown · 75 without an institution code

09Environmental DNA62 detections

Where the DNA of Hygromia limbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 7.20–15.2

Seasonal swing summer↔winter16.1 °C

Max temp (day)17.0 °C 11.6–20.1

Min temp (night)8.40 °C 2.80–9.00

Precipitation72.5 mm/mo 33.4–122

Air humidity59.8 % 52.9–61.7

Moisture balance-33.9 mm/mo -61.7–58.4

Vapour deficit577 Pa 410–953

Wind speed2.80 m/s 2.00–4.20

Cloud cover38.3 % 35.5–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hygromia limbata

At a glance

Sources9 archives

At a glance

Record type1 398 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 398 records