Hydrocotyle sibthorpioides
Lam. · speciesAt a glance
Occurrence records13 054
Data sources10
Biological traits48
DNA specimens12
eDNA detections5
Sources10 archives
Databases and archives Hydrocotyle sibthorpioides's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 054 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics12 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources48 traits
Chemical compositionNPASS9 compounds
Occurrence & distributionGBIF13 054 records
Environmental DNA1 datasets · 2 countries5 detections
DNA & barcodingBOLD · NCBI12 specimens
Genome at a glanceCCDB2n = 48
01Narrative
Hydrocotyle confusa là một loài thực vật có hoa trong Họ Cuồng. Loài này được H.Wolff mô tả khoa học đầu tiên năm 1927.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYAusTraitsLEDAGIFTWCVP
Size & morphology21
Fruit length1 mm
⚠ sources differ — AusTraits: 1 mm · GIFT: 1.2 mm
Fruit length max1.4 mm
Fruit length min1 mm
Fruit width1 mm
⚠ sources differ — AusTraits: 1 mm · GIFT: 1.6 mm
Fruit width max2 mm
Fruit width min1.2 mm
Leaf length8.5 mm
⚠ sources differ — AusTraits: 8.5 mm · GIFT: 10 mm
Leaf length max15 mm
Leaf length min5 mm
Leaf mass per area22.92 g/m2
Leaf size314 mm²
Leaf width8.5 mm
Leaf width max25 mm
Leaf width min5 mm
Petiole length4.25 cm
Plant height0.1 m
Plant height max0.3 m
Plant height min0.1 m
Seed length2 mm
Seed mass0.286 mg
Seed width1 mm
Life cycle & reproduction11
Deciduousnessevergreen
Dispersal typeself
Flowering timennnnnnnnnynn
Life formhydrosubshrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Resprouting capacityresprouts
Self fertilizationpresent
Sex typehermaphrodite+monoecious
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatemontane tropical
Climberself-supporting
Elevation max3 000 m
Elevation mean1 738 m
Elevation min100 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typemericarp
Growth formherb
Leaf compoundnesssimple
Leaf shapecordate orbicular reniform
Woodinesswoody
⚠ sources differ — TRY: W · AusTraits: herbaceous · GIFT: woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition9 compounds
Compounds documented for Hydrocotyle sibthorpioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile3 classes
Oleanane triterpenoids4
Chalcones2
Simple coumarins1
Documented compounds9 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,7R,8S,8aR,9R,10R,12aS,14aR,14bR)-9-acetyloxy-7,8-dihydroxy-8a-(hydroxymethyl)-4,4,6a,6b,11,11,14b-heptamethyl-10-(2-methylpropanoyloxy)-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | NPASS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,7R,8S,8aR,9R,10R,12aS,14aR,14bR)-9-acetyloxy-7,8-dihydroxy-8a-(hydroxymethyl)-4,4,6a,6b,11,11,14b-heptamethyl-10-(2-methylpropanoyloxy)-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3-hydroxy-4,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxane-2-carboxylic acid | present | NPASS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,7R,8S,8aR,9R,10R,12aS,14aR,14bR)-9-acetyloxy-7,8-dihydroxy-8a-(hydroxymethyl)-4,4,6a,6b,11,11,14b-heptamethyl-10-(2-methylpropanoyloxy)-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxyoxane-2-carboxylic acid | present | NPASS | |
| 3-Geranyl-4,2',4',6'-tetrahydroxy-5-prenyldihydrochalcone | present | NPASS | |
| 4,2',4',6'-Tetrahydroxy-3,5-diprenyldihydrochalcone | present | NPASS | |
| [(3R,4R,4aR,5S,6R,6aR,6aS,6bR,8aR,10S,12aR,14bS)-4-acetyloxy-5,6-dihydroxy-10-[(2R,3R,4S,5S,6R)-4-hydroxy-3,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]-6-[[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxy-4a-(hydroxymethyl)-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicen-3-yl] 2-methylpropanoate | present | NPASS | |
| KKBFJZIYDKQJNO-BIYNCIISSA-N | present | NPASS | |
| PMOWTIHVNWZYFI-WAYWQWQTSA-M | present | NPASS | |
| Thamnosmonin | present | NPASS |
05DNA & barcoding12 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hydrocotyle sibthorpioides has left across the world's sequence archives.
At a glance
DNA specimens12
Marker genes4
GenBank sequences10
eDNA detections5
Countries4
The DNA barcodea real sequence read deposited for this species
AAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTC …
Hydrocotyle sibthorpioides isolate Hyct14 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL5★ITS★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Hydrocotyle sibthorpioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidypolyploid inferred
Chromosome records18–482n range24median48mode7records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 483×CCDB · ita-fl · CCDB · ipcn-api-dl
CCDB · ita-fl — AMADEI L., GIORDANI A., TOMEI P.E. - 1982. Numeri cromosomici per la flora italiana:882-888.. Inform. Bot. Ital. , 14(2-3): 243-247.
CCDB · ipcn-api-dl — Amadei, L., A. Giordani & P. E. Tomei. 1982. Numeri cromosomici per la Flora Italiana: 882-888. Inform. Bot. Ital. 14: 243–247.
2n 182×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Subramanian, D. 1986. Cytotaxonomical studies in south Indian Apiaceae. Cytologia 51: 479–488.
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
2n 242×CCDB · nw-europe-fl · CCDB · book-indian_vol1
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3229
CCDB · book-indian_vol1 — Sharma, A.K. & Bhattacharyya, N. K.1959b
n 123×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — HORE, A. 1976a. Study of the structure and behaviour of chromosomes of different agricultural strains of Coriandrum sativum (coriander). Proc. Indian Sci. Congr. Assoc. 63: 117.
CCDB · book-ipcn67-71 — KORDYUM, E. L. 1967. Cyto-embryology of Umbellates. (In Russian). Naukova Dumka, Kiev, 1967, 128pp.
n 91×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Krishnappa, D. G. & A. N. Basappa. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
n 241×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Constance, L., T. i. Chuang & C. R. Bell. 1976. Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608–625.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type13 054 records
Wild obs. + sensor10 885
Museum / vouchered2 112
Other57
Origin
Native211
Introduced1
Range
Area of Occupancy AOO30 948 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy94% within 1 km
≤100 m 8 217≤1 km 1 315≤10 km 411>10 km 191
10 134 georeferenced · 751 without coordinates
Open the mapobservation + sensor10 885
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 127≤1 km 257≤10 km 327>10 km 48
759 georeferenced · 1 353 without coordinates
Open the institutions mapphysical evidence2 112
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions98 of 164 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Mount Annan, AU | 185 |
| Museo Entomologico de Leonlocation not on record | 185 |
| Olocation not on record | 143 |
| Canberra, AU | 135 |
| Nanjing, CN | 113 |
| Odawara, JP | 101 |
| Hobart, AU | 94 |
| Beijing, CN | 82 |
| Sanda, JP | 52 |
| Kunming, CN | 36 |
| Armidale, AU | 32 |
| Guangzhou, CN | 26 |
| Philadelphia, US | 26 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 23 |
| Kochi, JP | 22 |
| Chengdu, CN | 20 |
| Chapel Hill, US | 20 |
| Taipei, TW | 19 |
| Paris, FR | 18 |
| Bando, JP | 18 |
| Nagatoro-machi, Chichibu-gun, JP | 17 |
| Pretoria, ZA | 17 |
| Guilin, CN | 17 |
| TAIElocation not on record | 17 |
| MeiseBGlocation not on record | 16 |
| Nishihara, JP | 16 |
| Nagano City, JP | 16 |
| Tomioka, JP | 15 |
| Kew, GB | 15 |
| JP | 13 |
| Chiba, JP | 12 |
| Tsukuba, JP | 12 |
| Osaka, JP | 11 |
| Wuhan, CN | 11 |
| Edinburgh, GB | 11 |
| Chongqing Museumlocation not on record | 10 |
| Saint Louis, US | 10 |
| Yangling, CN | 10 |
| Toyama, JP | 10 |
| Bronx, US | 10 |
| Yunnan Universitylocation not on record | 9 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 9 |
| Awka, NG | 9 |
| Brisbane, AU | 9 |
| QVMAGlocation not on record | 9 |
| Wollongong, AU | 8 |
| Clemson, US | 8 |
| Taipei, TW | 8 |
| Chengdu, CN | 7 |
| Kagoshima, JP | 7 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| Shinshu Universitylocation not on record | 7 |
| Shanghai, CN | 7 |
| Little Rock, US | 6 |
| Williamsburg, US | 6 |
| Taipei, TW | 6 |
| Guiyang, CN | 6 |
| Tokushima, JP | 6 |
| Parthenon Tama History Museumlocation not on record | 6 |
| University of Stellenboschlocation not on record | 6 |
| Jishou Universitylocation not on record | 6 |
| Columbia, US | 6 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 6 |
| BClocation not on record | 5 |
| Seoul, KR | 5 |
| KURAlocation not on record | 5 |
| Yaoundé, CM | 5 |
| Changsha, CN | 5 |
| 湖北神农架林区标本馆location not on record | 5 |
| Sagamihara, JP | 5 |
| Adelaide, AU | 5 |
| Jackson, US | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Xiamen, CN | 5 |
| Allentown, US | 5 |
| Honolulu, US | 4 |
| Guangzhou, CN | 4 |
| Wuzhou, CN | 4 |
| KOMlocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| CRSN_LWIROlocation not on record | 4 |
| BIO-UNIPIlocation not on record | 4 |
| Nishihara, JP | 4 |
| National Museums of Kenyalocation not on record | 4 |
| Smithfield, AU | 4 |
| Appalachian State Universitylocation not on record | 3 |
| Hangzhou, CN | 3 |
| Millersville, US | 3 |
| Wuhan, CN | 3 |
| Bangkok, TH | 3 |
| Wlocation not on record | 3 |
| Dehra Dun, IN | 3 |
| Parkville, AU | 3 |
| CASlocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| Uppsala, SE | 3 |
| KIRMlocation not on record | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Batemans Bay, AU | 3 |
| Claremont, US | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| 盐城国家级珍禽自然保护区location not on record | 2 |
| BISHlocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Riverside, US | 2 |
| US | 2 |
| Fairfax, US | 2 |
| Xian, CN | 2 |
| South Kensington, GB | 2 |
| FFPRIlocation not on record | 2 |
| Vancouver, CA | 2 |
| Bloomington, US | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Brussel, BE | 2 |
| Philadelphia, US | 2 |
| Peking Universitylocation not on record | 2 |
| Zhejiang Universitylocation not on record | 2 |
| Elocation not on record | 2 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| Davis, US | 2 |
| Edmonton, CA | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Minia, EG | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Nanjing, CN | 1 |
| AUAlocation not on record | 1 |
| Université du Lomélocation not on record | 1 |
| Pondicherry, IN | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Shenzhen, CN | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Burlington, US | 1 |
| GAlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| San Diego, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| GMBAlocation not on record | 1 |
| Sendai, JP | 1 |
| SJNAlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Morgantown, US | 1 |
| PRClocation not on record | 1 |
| Fayetteville, US | 1 |
| CJBGlocation not on record | 1 |
| Tampa, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Phoenix, US | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| Shanghai, CN | 1 |
| SXTCMlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Plocation not on record | 1 |
| SIHUlocation not on record | 1 |
| Fort Worth, US | 1 |
| Palmerston, AU | 1 |
| Fukushima Universitylocation not on record | 1 |
| Guiyang, CN | 1 |
164 institutions · 2 011 of 2 112 vouchered records shown · 101 without an institution code
09Environmental DNA5 detections
Where the DNA of Hydrocotyle sibthorpioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map2 countries0
Roadsides on slopesGrassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.8 °C 20.8–24.7
Seasonal swing summer↔winter15.9 °C
Max temp (day)24.8 °C 23.7–29.3
Min temp (night)19.3 °C 17.1–20.5
Precipitation238 mm/mo 135–268
Air humidity69.5 % 55.5–70.7
Moisture balance107 mm/mo 7.20–162
Vapour deficit800 Pa 743–1,453
Wind speed2.30 m/s 1.90–3.00
Cloud cover53.1 % 30.8–58.0
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.