Hydrocotyle bonariensis
Comm. ex Lam. · speciesAt a glance
Occurrence records10 846
Data sources13
Biological traits41
DNA specimens4
eDNA detections3
Sources13 archives
Databases and archives Hydrocotyle bonariensis's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 840 records↗
OBISOcean Biodiversity Information System6 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics4 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Occurrence & distributionGBIF · OBIS10 846 records
Environmental DNA1 datasets · 1 countries3 detections
DNA & barcodingBOLD · NCBI4 specimens
Genome at a glanceCCDB2n = 22
01Narrative
Hydrocotyle bonariensis, the largeleaf pennywort, once a member of the family Apiaceae, now in the family Araliaceae and of the genus Hydrocotyle, is a hairless and creeping perennial. Hydrocotyle bonariensis
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology15
Fruit length1.75 mm
Fruit width2.75 mm
Leaf length75 mm
Leaf length max120 mm
Leaf length min30 mm
Leaf size2 770 mm²
Leaf width45 mm
Leaf width max120 mm
Leaf width min30 mm
Petiole length8.5 cm
Plant height max0.3 m
Plant height min0.1 m
Seed mass1.3 mg
Seed mass max1.3 mg
Seed mass min1.3 mg
Life cycle & reproduction9
Deciduousnessevergreen
Dispersal typewind
Flowering endFeb
Flowering startOct
Flowering timeyynnnnnnnyyy
Life formsubshrub
Life spanperennial
Raunkiær life formcryptophyte
Resprouting capacityresprouts
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 500 m
Elevation mean1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typemericarp
Growth formherb
Habitat GIFTÁrea Antrópica, Restinga
Leaf compoundnesssimple
Leaf shapepeltate
Mycorrhiza type0.0000103
Woodinessnon-woody
Physiology & chemistry2
Photosynthetic pathwayC3
Specific leaf area (SLA)26.01 mm²/mg
05DNA & barcoding4 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hydrocotyle bonariensis has left across the world's sequence archives.
At a glance
DNA specimens4
Marker genes4
GenBank sequences10
eDNA detections3
Countries1
The DNA barcodea real sequence read deposited for this species
TTATGTAGCTTATCCATTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTTCTTCCATTGTAGGTAATGTATTTGGGTTCAAAGC …
Hydrocotyle bonariensis isolate Hyct37 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK6★rbcL4★rbcLa★ITS
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Hydrocotyle bonariensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidypolyploid inferred
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 221×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Covas & S. 1946
n 482×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — CONSTANCE, L . T.-I. CHUANG, & C.R. BELL. 1971. Chromosome numbers in Umbelliferae. IV. Amer. J. Bot. 58: 577-587.
CCDB · CromoCat 2015 — Constance, L., Chuang, T. & Bell, C. R. (1971). Chromosome numbers in Umbelliferae. IV. Amer. J. Bot. 58: 577-587.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type10 846 records
Wild obs. + sensor8 713
Museum / vouchered2 031
Other102
Origin
Native199
Introduced2 190
Range
Area of Occupancy AOO18 668 km²
Depth
0–200 m sunlit6
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1 m · max 1 m · 6 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 5 632≤1 km 1 120≤10 km 379>10 km 267
7 398 georeferenced · 1 315 without coordinates
Open the mapobservation + sensor8 713
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 329≤1 km 104≤10 km 203>10 km 44
680 georeferenced · 1 351 without coordinates
Open the institutions mapphysical evidence2 031
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions109 of 230 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 179 |
| Mount Annan, AU | 95 |
| Bronx, US | 91 |
| Saint Louis, US | 90 |
| Mexico City, MX | 70 |
| Canberra, AU | 68 |
| Tampa, US | 47 |
| Pretoria, ZA | 45 |
| Córdoba, AR | 40 |
| Jena Microbial Resource Collectionlocation not on record | 35 |
| San Isidro, AR | 35 |
| Bangkok, TH | 33 |
| Brisbane, AU | 29 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 29 |
| Museo Entomologico de Leonlocation not on record | 28 |
| Blumenau, BR | 27 |
| Kew, GB | 26 |
| Corrientes, AR | 25 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 24 |
| Yaoundé, CM | 23 |
| Durban, ZA | 23 |
| US | 23 |
| Mérida, MX | 20 |
| Auckland, NZ | 20 |
| Austin, US | 18 |
| Chicago, US | 17 |
| MAlocation not on record | 16 |
| Plocation not on record | 16 |
| Armidale, AU | 16 |
| University of Stellenboschlocation not on record | 15 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 14 |
| Wuzhou, CN | 14 |
| GAlocation not on record | 14 |
| Miami, US | 14 |
| MeiseBGlocation not on record | 13 |
| UNESClocation not on record | 13 |
| ISAlocation not on record | 13 |
| Tuscaloosa, US | 12 |
| WAGlocation not on record | 12 |
| Criciúma, BR | 11 |
| Jackson, US | 11 |
| Ivano-Frankivsk, UA | 10 |
| Adelaide, AU | 10 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 10 |
| LBVlocation not on record | 10 |
| AUAlocation not on record | 10 |
| Mississippi State, US | 9 |
| Chongqing Museumlocation not on record | 9 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 9 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 9 |
| Maringá, BR | 9 |
| Herbier National du Gabonlocation not on record | 8 |
| UFSClocation not on record | 8 |
| Wollongong, AU | 8 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 8 |
| PUC-RSlocation not on record | 7 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 7 |
| Valdosta State Universitylocation not on record | 7 |
| Columbia, US | 7 |
| Appalachian State Universitylocation not on record | 7 |
| UFBAlocation not on record | 7 |
| Kensington, AU | 7 |
| JBRJlocation not on record | 6 |
| HNBlocation not on record | 6 |
| CEPLAClocation not on record | 6 |
| Knoxville, US | 6 |
| Chapel Hill, US | 6 |
| Université de Bordeauxlocation not on record | 6 |
| Masindi, UG | 6 |
| Fort Worth, US | 6 |
| Laboratorio de Ictiologialocation not on record | 6 |
| Chaguaramas, TT | 6 |
| San Francisco de Campeche, MX | 5 |
| Salvador, BR | 5 |
| Universidade Federal de Santa Catarinalocation not on record | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| EL PASO, US | 5 |
| Batemans Bay, AU | 5 |
| Norfolk, US | 5 |
| Universidade Federal do Vale do São Franciscolocation not on record | 5 |
| Cascavel, BR | 5 |
| Castelar, AR | 5 |
| USP-IBlocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Leiden University Medical Centerlocation not on record | 5 |
| Santa Cruz de la Sierra, BO | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Instituto de Investigação Científica Tropicallocation not on record | 4 |
| Feira de Santana, BR | 4 |
| Universidade Federal de Sergipe (UFS)location not on record | 4 |
| UNIVASFlocation not on record | 4 |
| Bloomington, US | 4 |
| Brussels, BE | 4 |
| San Diego, US | 4 |
| UTFPR-CPlocation not on record | 4 |
| Campo Grande, BR | 4 |
| BRNUlocation not on record | 4 |
| UEMlocation not on record | 4 |
| UFMSlocation not on record | 4 |
| Taipei, TW | 3 |
| UFESlocation not on record | 3 |
| UnBlocation not on record | 3 |
| València, ES | 3 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 3 |
| Lake Charles, US | 3 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 3 |
| EAlocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Riverside, US | 3 |
| IPA/SPlocation not on record | 3 |
| INMAlocation not on record | 3 |
| Granada, ES | 3 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 3 |
| Federal University of Espírito Santolocation not on record | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| Paris, FR | 3 |
| Campo Mourão, BR | 3 |
| Logan, US | 3 |
| UNESP-FCAlocation not on record | 3 |
| Fortaleza, BR | 3 |
| UFMGlocation not on record | 3 |
| Aarhus, DK | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| Paleontological Collectionlocation not on record | 2 |
| University of Johannesburglocation not on record | 2 |
| ASUlocation not on record | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Salamanca, ES | 2 |
| NO DISPONIBLElocation not on record | 2 |
| Ilhéus, BR | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| UFPElocation not on record | 2 |
| STUlocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Calabar, NG | 2 |
| Instituto do Meio Ambientelocation not on record | 2 |
| Pelotas, BR | 2 |
| UFPRlocation not on record | 2 |
| IPHAMETRAlocation not on record | 2 |
| Arequipa, PE | 2 |
| Sucre, BO | 2 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 2 |
| Little Rock, US | 2 |
| León, NI | 2 |
| Universidade da Região de Joinville - Univillelocation not on record | 2 |
| GB | 2 |
| Williamsburg, US | 2 |
| UNESP-RClocation not on record | 2 |
| Tapachula, MX | 2 |
| Hobart, AU | 2 |
| UNIVILLElocation not on record | 2 |
| Londrina, BR | 2 |
| Edinburgh, GB | 2 |
| Clocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Flagstaff, US | 2 |
| Uppsala, SE | 2 |
| Museo Achille Folettolocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Mérida, MX | 2 |
| Valparaiso, CL | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Botanic Gardenlocation not on record | 2 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 2 |
| Charleston Southern Universitylocation not on record | 2 |
| Davis, US | 1 |
| La Trobe Universitylocation not on record | 1 |
| Madrid, ES | 1 |
| Millersville, US | 1 |
| Cambridge, US | 1 |
| BRLUlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| La Paz, BO | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| CJBGlocation not on record | 1 |
| Burlington, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Anton de Kom University of Surinamelocation not on record | 1 |
| Dekalb, US | 1 |
| Clemson, US | 1 |
| UFSMlocation not on record | 1 |
| IECOSlocation not on record | 1 |
| Phoenix, US | 1 |
| MEXUlocation not on record | 1 |
| Waverly, US | 1 |
| MMHNSRlocation not on record | 1 |
| Santa Maria, BR | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| LISClocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Cusco, PE | 1 |
| Foz do Iguaçu, BR | 1 |
| Wlocation not on record | 1 |
| LDlocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Brasília, BR | 1 |
| REALlocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Vitoria, ES | 1 |
| BAYLUlocation not on record | 1 |
| Berlin, DE | 1 |
| MVMlocation not on record | 1 |
| Long Beach, US | 1 |
| Cruz das Almas, BR | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Boise, US | 1 |
| FUVATESlocation not on record | 1 |
| LGlocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Hudson, US | 1 |
| UNISANTAlocation not on record | 1 |
| Emporia, US | 1 |
| UDESC-CAVlocation not on record | 1 |
| Denver, US | 1 |
| FUNEDlocation not on record | 1 |
| Xiamen, CN | 1 |
| CASlocation not on record | 1 |
| Wellington, NZ | 1 |
| Moscow State Universitylocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Guatemala City, GT | 1 |
| Bogotá, D.C., CO | 1 |
| Lubbock, US | 1 |
| Santiago de Cali, CO | 1 |
230 institutions · 1 944 of 2 031 vouchered records shown · 87 without an institution code
09Environmental DNA3 detections
Where the DNA of Hydrocotyle bonariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.2 °C 22.2–22.2
Seasonal swing summer↔winter5.90 °C
Max temp (day)24.0 °C 23.8–24.1
Min temp (night)20.2 °C 20.1–20.3
Precipitation58.8 mm/mo 51.6–66.0
Air humidity61.2 % 61.1–61.4
Moisture balance-104 mm/mo -115–-93.4
Vapour deficit1,032 Pa 1,025–1,039
Wind speed6.30 m/s 5.80–6.80
Cloud cover20.3 % 16.1–24.5
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.