Hydrilla verticillata
(L.f.) Royle · speciesAt a glance
Occurrence records10 995
Data sources13
Biological traits53
DNA specimens28
eDNA detections20
Sources13 archives
Databases and archives Hydrilla verticillata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 995 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources53 traits
Chemical compositionLOTUS28 compounds
Occurrence & distributionGBIF10 995 records
Environmental DNA1 datasets · 3 countries20 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB · GoaT2n = 16
01Narrative
Hydrilla est un genre de plantes aquatiques souvent traité comme ne contenant qu'une seule espèce, bien que certains botanistes y rangent plusieurs autres espèces ou considèrent qu'il existe des variants bien marqués. Depuis qu'elle a été introduite en Amérique du Nord, cette espèce y est devenue l'une des plus invasives pour les eaux douces libres et certaines zones humides. Elle résiste temporairement bien aux apports d'eaux saumâtres.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDATRYAusTraitsGIFTWCVP
Size & morphology15
Fruit length7 mm
Fruit length max15 mm
Fruit length min5 mm
Fruit width1.5 mm
Fruit width max1.5 mm
Leaf length30 mm
Leaf length max15 mm
Leaf size32 mm²
Leaf width5 mm
Leaf width max4 mm
Leaf width min2 mm
Plant height1 m
Plant height max2 m
Seed length2 mm
Seed width0.8 mm
Life cycle & reproduction17
Deciduousnessevergreen
Dispersal typewater
⚠ sources differ — AusTraits: hydrochory · LEDA: autochor · GIFT: autochorous
Flower colourwhite
Flower length max2 mm
Flowering endAug
Flowering startDec
Flowering timeyynnnnnnnyyy
Life formhydrosubshrub
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
⚠ sources differ — AusTraits: wind · GIFT: water
Raunkiær life formcryptophyte
Reproduction asexualpresent
Resprouting capacityresprouts
Seed number6
Self fertilizationabsent
Sex typedioecious
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticaquatic
Climatewet tropical
Climberself-supporting
Elevation max3 000 m
Elevation mean425 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeutricle
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Aquatic
Habitat GIFTbrackish water, lakes, swamps
Leaf formelliptic
Leaf shapeelliptical lanceolate linear strap-shaped widely_ovate
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
⚠ sources differ — TRY: C3 · AusTraits: c4 · GIFT: C3
Other traits3
Diaspore typevegetative
Leaf arrangementwhorled
Shoot length max300 cm
03Chemical composition28 compounds
Compounds documented for Hydrilla verticillata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Aminoacids20
Polyamines5
Acetate-derived alkaloids $ Polyamines1
Aminoacids $ Dipeptides1
Documented compounds28 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Valine | present | LOTUS | |
| (2R)-2-azaniumyl-3-phenylpropanoate | present | LOTUS | |
| (2S)-2-(phenylazaniumyl)propanoate | present | LOTUS | |
| (2S)-2-ammonio-3-(1H-imidazol-4-yl)propanoate | present | LOTUS | |
| (2S)-2-ammonio-3-(4-hydroxyphenyl)propanoate | present | LOTUS | |
| (2S,3S)-2-ammonio-3-methylpentanoate | present | LOTUS | |
| 2,2-Propanediamine | present | LOTUS | |
| 4,4'-Diaminodibutylamine | present | LOTUS | |
| Arginine | present | LOTUS | |
| d,l-Serine | present | LOTUS |
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hydrilla verticillata has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes5
GenBank sequences10
eDNA detections20
Countries7
The DNA barcodea real sequence read deposited for this species
CCCCCCCCCCACTTACGTGCGGCGGCAACGGAATATGGCCTTCCGCGTTTTGACGCGGTGGCCGAATGTCGTTTTAGGGGCTATGCCTCC …
Hydrilla verticillata voucher DWQGZ184 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL9★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hydrilla verticillata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidypolyploid inferred
Chromosome records16–322n range16median16mode30records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1617×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · poland +6
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Scannell, M.J.P., Czapik, R. Watsonia 12: 397 (1979)
CCDB · poland — Czapik R. 1978. The karyology of Hydrilla (Hydrocharitaceae) from Ireland and Poland. Proc. Royal Irish. Acad. Sect. B, 78, 267-272.
CCDB · ipcn-api-dl — Wang, N. z. 1986. Chromosome numbers and karyotype analysis of 9 species in Hydrocharitaceae. Acta Phytotax. Sin. 24: 370–375.
CCDB · ipcn-api-dl — Pandita, T. K. & P. N. MEHRA. 1984. Cytological studies of some Helobiales of Kashmir Himalayas II. Families: Butomaceae and Hydrocharitaceae. Cytologia 49: 305–312.
CCDB · ipcn-api-dl — Probatova, N. S. & T. G. Buch. 1981. Hydrilla verticillata (Hydrocharitaceae) in the Soviet Far East. Bot. Zhurn. SSSR 66(2): 208–214.
CCDB · ipcn-api-dl — Uchiyama, H. 1989. Karyomorphological studies on some taxa of the Helobiae. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 22: 271–352.
CCDB · ipcn-api-dl — Langland, K. A., D. G. Shilling, J. L. Carter, F. B. Laroche, K. K. Steward & P. T. Madiera. 1992. Chromosome morphology and number in various populations of Hydrilla verticillata (L. f.) Royle. Aquatic Bot. 42: 253–263.
CCDB · ipcn-api-dl — CZAPIK, R. 1978. The karyology of Hydrilla (Hydrocharitaceae) from Ireland and Poland. Proc. Roy. Irish Acad. 78 (17): 267–272.
CCDB · ipcn-api-dl — CZAPIK, R. & H. Tomaszewicz. 1979. The water thyme, Hydrilla verticillata, flowers in the Suwalki Lake District. Chrońmy Przyr. Ojczystą 35 (4): 26–36.
CCDB · ipcn-api-dl — FOTEDAR, J. L. & S. K. Roy. 1974. Biosystematics of some Indian Hydrocharitaceae with notes on the evolutionary status of its members. Pp. 357-364 in P. Kachroo (ed.), Advancing Frontiers in Cytogenetics. Hindustan Publ. Co., Dehli.
CCDB · ipcn-api-dl — Probatova. 2006. Chromosome numbers of vascular plants from nature reserves of the Primorsky Territory and the Amur River basin. Bot. Žhurn. (Moscow & Leningrad) 91(7): 1117–1134.
CCDB · book-indian_vol2 — Rao, Y.S. 1950b; Larsen, K. 1963b ; Czapik, R. 1978; Mehra, P.N. & Pandita, T.K. 1978
CCDB · eflora
CCDB · book-fedorov — Larsen 1963b
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · Cave1963 — Larsen 1963b
2n 2411×CCDB · poland · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +4
CCDB · poland — Czapik R. 1978. The karyology of Hydrilla (Hydrocharitaceae) from Ireland and Poland. Proc. Royal Irish. Acad. Sect. B, 78, 267-272.
CCDB · ipcn-api-dl — Sarkar, A. K. 1985. Taxonomy of certain members of Helobiae as judged from a cytological standpoint. Proc. Indian Sci. Congr. Assoc. 72(3–VI): 134–135.
CCDB · ipcn-api-dl — Sarkar, A. K., M. Chakraverty, S. K. DAS, C. R. Pal & D. Hazara. 1980. In Chromosome number reports LXVII. Taxon 29: 358–360.
CCDB · ipcn-api-dl — Nakata, M. & S. Nagai. 1998. Chromosome numbers of some aquatic plants collected in Toyama Prefecture. Bull. Bot. Gard. Toyama 37: 1–6.
CCDB · book-ipcn73-74 — SARKAR, A.K., N. DATTA., & U. CHATTERJEE. 1973. In IOPB chromosome number reports XLII. Taxon 22: 647-654.
CCDB · book-indian_vol2 — Sinoto, Y. & Kiyohara, K.~ 1928 ; Harada, I. 1956 ; Sharma, A.K. & Bhattacharyya, B. 1956; Sarkar, A.K., Datta, N. & Chatterjee, U. 1973a, 1980
CCDB · eflora
CCDB · book-fedorov — Sinota, Kiyohara 1928
CCDB · book-fedorov — Harada 1956
CCDB · book-fedorov — Sharma A. K., Bhattacharyya B. 1956
CCDB · Cave1956 — Harada; Sharma &B.Bhattach.
2n 322×CCDB · ipcn-api-dl · CCDB · book-indian_vol2
CCDB · ipcn-api-dl — Davenport, L. J. 1980. In Chromosome number reports LXVII. Taxon 29: 351.
CCDB · book-indian_vol2 — Davenport, L.J. 1980
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.988 ↗
08Occurrence & distribution
Record type10 995 records
Wild obs. + sensor3 666
Museum / vouchered2 296
Cultivated / captive2
Fossil1
Other5 030
Origin
Native109
Introduced7
Range
Area of Occupancy AOO15 288 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 1 317≤1 km 249≤10 km 158>10 km 179
1 903 georeferenced · 1 763 without coordinates
Open the mapobservation + sensor3 666
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 143≤1 km 261≤10 km 399>10 km 110
913 georeferenced · 1 383 without coordinates
Open the institutions mapphysical evidence2 296
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 2 records without
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions119 of 210 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 103 |
| Mount Annan, AU | 95 |
| Tsukuba, JP | 91 |
| Museo Entomologico de Leonlocation not on record | 88 |
| Brisbane, AU | 85 |
| Hokkaido University Museumlocation not on record | 80 |
| Canadian Department of Agriculturelocation not on record | 69 |
| Palmerston, AU | 49 |
| Tampa, US | 45 |
| Kunming, CN | 37 |
| South Kensington, GB | 33 |
| Canberra, AU | 33 |
| Knoxville, US | 32 |
| Baroda, IN | 29 |
| Fukushima Universitylocation not on record | 27 |
| Sanda, JP | 27 |
| Guangzhou, CN | 25 |
| Toyama, JP | 25 |
| Bangkok, TH | 25 |
| Chongqing Museumlocation not on record | 24 |
| Jena Microbial Resource Collectionlocation not on record | 24 |
| Saint Louis, US | 23 |
| Philadelphia, US | 23 |
| Henderson State Universitylocation not on record | 21 |
| Irkutsk State Universitylocation not on record | 21 |
| Uniwersytet Wrocławskilocation not on record | 21 |
| Kensington, AU | 21 |
| Moscow State Universitylocation not on record | 20 |
| Chicago, US | 20 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 19 |
| Kushiro City Museumlocation not on record | 17 |
| Kochi, JP | 16 |
| Miami, US | 16 |
| Kew, GB | 16 |
| National Biodiversity Institute, Costa Ricalocation not on record | 15 |
| Adelaide, AU | 15 |
| Taipei, TW | 15 |
| Nanjing, CN | 14 |
| Guilin, CN | 14 |
| Wuhan, CN | 13 |
| NSMKlocation not on record | 13 |
| Auckland, NZ | 13 |
| Davis, US | 12 |
| Dresden, DE | 12 |
| Morgantown, US | 12 |
| Nagano City, JP | 12 |
| JP | 12 |
| KIWElocation not on record | 11 |
| Austin, US | 11 |
| BISONlocation not on record | 11 |
| SIHUlocation not on record | 11 |
| College Park, US | 10 |
| Xiamen, CN | 9 |
| Tuscaloosa, US | 9 |
| Christchurch, NZ | 8 |
| Fairfax, US | 8 |
| GMBAlocation not on record | 8 |
| Durham, US | 8 |
| Riverside, US | 7 |
| BMlocation not on record | 7 |
| Fort Worth, US | 7 |
| Tokushima, JP | 7 |
| KURAlocation not on record | 7 |
| Durban, ZA | 6 |
| US | 6 |
| San Diego, US | 6 |
| James Cook Townsvillelocation not on record | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| MeiseBGlocation not on record | 6 |
| Paris, FR | 6 |
| Bronx, US | 6 |
| Little Rock, US | 6 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| Mexico City, MX | 6 |
| Taipei, TW | 6 |
| BAYLUlocation not on record | 5 |
| TAIElocation not on record | 5 |
| Antiguo Cuscatlán, SV | 5 |
| San José, CR | 5 |
| Jackson, US | 5 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 5 |
| Zhejiang Universitylocation not on record | 5 |
| Chengdu, CN | 5 |
| Nanjing, CN | 5 |
| University of Stellenboschlocation not on record | 5 |
| Pondicherry, IN | 5 |
| Tomioka, JP | 5 |
| Chapel Hill, US | 5 |
| Servico de Microbiologia e Imunologialocation not on record | 5 |
| Sendai, JP | 5 |
| Awka, NG | 5 |
| Millersville, US | 5 |
| Columbia, US | 4 |
| Philadelphia, US | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Valdosta State Universitylocation not on record | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 4 |
| Hobart, AU | 4 |
| Claremont, US | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| Armidale, AU | 4 |
| Madison, US | 4 |
| Kagoshima, JP | 4 |
| Bloomington, US | 4 |
| Smithfield, AU | 4 |
| QAUlocation not on record | 4 |
| Chiba, JP | 4 |
| Odawara, JP | 4 |
| Mississippi State, US | 4 |
| Kyoto Universitylocation not on record | 3 |
| GB | 3 |
| Minia, EG | 3 |
| ASUlocation not on record | 3 |
| CASlocation not on record | 3 |
| Yunnan Universitylocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| University of New Hampshirelocation not on record | 3 |
| Williamsburg, US | 3 |
| Peking Universitylocation not on record | 3 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Chengdu, CN | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Elocation not on record | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Xian, CN | 2 |
| Guangzhou, CN | 2 |
| BM|Elocation not on record | 2 |
| NMWlocation not on record | 2 |
| Pittsburg, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| Toronto, CA | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| WTUlocation not on record | 2 |
| Hangzhou, CN | 2 |
| New Haven, US | 2 |
| Yangling, CN | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Wuzhou, CN | 2 |
| KR | 2 |
| Berlin, DE | 2 |
| Seoul, KR | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 2 |
| Changsha, CN | 2 |
| Guatemala, GT | 2 |
| Zürich, CH | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| Zhengzhou, CN | 2 |
| Texas Lutheran Universitylocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| BM|NMWlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Nishihara, JP | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Lincoln, US | 1 |
| Central China Normal Universitylocation not on record | 1 |
| San Jose, US | 1 |
| Shanghai, CN | 1 |
| Parkville, AU | 1 |
| Logan, US | 1 |
| Durham, US | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| CJBGlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Fayetteville, US | 1 |
| Ann Arbor, US | 1 |
| University of Leicesterlocation not on record | 1 |
| Longwood Universitylocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Flagstaff, US | 1 |
| Santa Barbara, US | 1 |
| LDlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| University of Santo Tomas Herbariumlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Durango, MX | 1 |
| St. Augustine, TT | 1 |
| KIRMlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Norfolk, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| BM|E|NMWlocation not on record | 1 |
| Texas A&M Universitylocation not on record | 1 |
| Osaka, JP | 1 |
| Green Bay, US | 1 |
| Campo Mourão, BR | 1 |
| Wlocation not on record | 1 |
| Stockholm, SE | 1 |
| Elikins, US | 1 |
| Maringá, BR | 1 |
| Guatemala City, GT | 1 |
| Foz do Iguaçu, BR | 1 |
| UTFPR-CPlocation not on record | 1 |
| Pullman, US | 1 |
| ENTClocation not on record | 1 |
| Clemson, US | 1 |
| Arcata, US | 1 |
| Dekalb, US | 1 |
| JMSlocation not on record | 1 |
210 institutions · 1 990 of 2 296 vouchered records shown · 306 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Hydrilla verticillata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map3 countries0
Forested mountain slopes
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.5 °C 14.7–26.9
Seasonal swing summer↔winter11.7 °C
Max temp (day)25.7 °C 17.4–32.2
Min temp (night)18.8 °C 11.7–21.4
Precipitation144 mm/mo 53.0–227
Air humidity66.0 % 53.9–67.0
Moisture balance76.1 mm/mo -82.0–112
Vapour deficit923 Pa 570–1,669
Wind speed3.80 m/s 2.40–4.20
Cloud cover50.8 % 13.3–54.4
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.