Hydriastele wendlandiana

(F.Muell.) H.Wendl. & Drude · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Hydriastele

At a glance

Occurrence records930

Data sources8

Biological traits41

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Hydriastele wendlandiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility930 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF930 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Hydriastele wendlandiana là loài thực vật có hoa thuộc họ Arecaceae. Loài này được (F.Muell.) H.Wendl. & Drude mô tả khoa học đầu tiên năm 1875.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit length8 mm

⚠ sources differ — AusTraits: 8 mm · GIFT: 9 mm

Fruit length max11 mm

Fruit length min7 mm

Fruit width8 mm

⚠ sources differ — AusTraits: 8 mm · GIFT: 6.62 mm

Fruit width max8 mm

Fruit width min5 mm

Leaf length500 mm

Leaf length max2 500 mm

Leaf width62.5 mm

Plant height20 m

⚠ sources differ — AusTraits: 20 m · TRY: 13.1 m

Plant height max10 m

Plant height min1 m

Seed length7 mm

Seed width8 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnnnyyyyyn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Fruit fleshinessfleshy

Fruit typedrupe

Growth formother

⚠ sources differ — GIFT: other · AusTraits: palmoid

Habitat GIFTcanopy

Leaf compoundnesscompound

Leaf shapelinear

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits6

Dbh max12 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max2 500 cm

Shoot orientationerect

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hydriastele wendlandiana has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences2

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496611.1 ↗566 bp

ACGT

CTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCT …

Hydriastele wendlandiana isolate AA_B02 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★trnL-F

plant barcode

08Occurrence & distribution

Record type930 records

Wild obs. + sensor347

Museum / vouchered549

Cultivated / captive4

Other30

Origin

Native20

Range

Area of Occupancy AOO1 908 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 98≤1 km 10≤10 km 2>10 km 3

113 georeferenced · 234 without coordinates

Open the mapobservation + sensor347

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 28≤1 km 70≤10 km 181>10 km 45

324 georeferenced · 225 without coordinates

Open the institutions mapphysical evidence549

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	125
Smithfield, AU	122
Kew, GB	73
Palmerston, AU	57
Brisbane, AU	46
Museo Entomologico de Leonlocation not on record	18
Mount Annan, AU	10
James Cook Townsvillelocation not on record	4
St. Paul, US	3
Miami, US	2
Saint Louis, US	1

11 institutions · 461 of 549 vouchered records shown · 87 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Hydriastele wendlandiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.90 °C 7.90–7.90

Seasonal swing summer↔winter15.4 °C

Max temp (day)11.0 °C

Min temp (night)4.70 °C

Precipitation75.2 mm/mo

Air humidity65.7 %

Moisture balance14.4 mm/mo

Vapour deficit403 Pa

Wind speed4.10 m/s

Cloud cover58.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)