Hydriastele microcarpa — The Life Data

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Hydriastele

At a glance

Occurrence records17

Data sources4

Biological traits21

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Hydriastele microcarpa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

NCBIUS National Library of Medicinesequences↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF17 records

DNA & barcodingNCBIsequences

01Narrative

Hydriastele microcarpa (formerly Gulubia microcarpa) is a species of flowering plant in the family Arecaceae. It is found only in Fiji where it is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length10 mm

Fruit width3 mm

Leaf length max2 200 mm

Plant height8 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourwhite

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits6

Dbh max15 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max800 cm

Shoot orientationerect

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hydriastele microcarpa has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692312.1 ↗476 bp

ACGT

AATTGTAGAATCCCGCGAACCATCGAGTCTTCGAATGCAAGTTGCACCCGAGGCCACCCGGCCAAGGGCACACCTGCCTGGACATCACGC …

Hydriastele microcarpa voucher XTBG047 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL3ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type17 records

Museum / vouchered17

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence17

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	7

1 institutions · 7 of 17 vouchered records shown · 10 without an institution code