Hyblaea ibidias

Turner, 1902 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hyblaeidae/Hyblaea

At a glance

Occurrence records141

Data sources7

Biological traits0

DNA specimens30

eDNA detections28

Sources7 archives

Databases and archives Hyblaea ibidias's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF141 records

Environmental DNA1 datasets · 1 countries28 detections

DNA & barcodingBOLD30 specimens

01Narrative

Hyblaea ibidias is a moth in the family Hyblaeidae. It is found in New South Wales, Australia. The larvae have been recorded feeding on Pandorea jasminoides.Teak Moths - Family Hyblaeidae at Brisbane Insects and Spiders. Retrieved October 31, 2017.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hyblaea ibidias has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes2

eDNA detections28

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

160Gmostly conserved

235Cvariable

247Tvariable

604Gmostly conserved

616Cmostly conserved

619Amostly conserved

AACTTTATATTTCATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTACTTATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes5

BIN1

Most divergent pair0.76%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cornifrons actualissame order8.8%Culladia serranellasame order8.9%Cotachena fulvomarginalissame order9.0%Ceratonyx satanariasame order9.0%Prorasea fernaldisame order9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type141 records

Wild obs. + sensor130

Museum / vouchered11

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 85≤1 km 30≤10 km 1>10 km 1

117 georeferenced · 13 without coordinates

Open the mapobservation + sensor130

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
ZSMlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
Museums Victorialocation not on record	1

3 institutions · 7 of 11 vouchered records shown · 4 without an institution code

09Environmental DNA28 detections

Where the DNA of Hyblaea ibidias was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map1 country0

Dry Sclerophyll Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 18.7–25.1

Seasonal swing summer↔winter10.3 °C

Max temp (day)27.6 °C 23.7–30.6

Min temp (night)19.0 °C 13.1–20.6

Precipitation116 mm/mo 42.1–201

Air humidity60.1 % 53.8–63.4

Moisture balance-40.4 mm/mo

Vapour deficit1,062 Pa 960–1,554

Wind speed2.70 m/s

Cloud cover29.5 % 21.0–34.2

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)