Hulsea algida — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hulsea

At a glance

Occurrence records923

Data sources10

Biological traits11

DNA specimens4

eDNA detections4

Sources10 archives

Databases and archives Hulsea algida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility923 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF923 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Hulsea algida is a species of flowering plant in the daisy family, known by the common name Pacific hulsea or alpine gold. It is native to the western United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.576 mg

Seed mass max0.576 mg

Seed mass min0.576 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Leaf n39 mg/g

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hulsea algida has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK749352.1 ↗646 bpUSA · 2013

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCA …

Hulsea algida ID:169146 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK9rbcL1ITSITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hulsea algida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · eflora

CCDB · eflora

n 191×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ORNDUFF, R., T. MOSQUIN, D. W. KYHOS, & P. H. RAVEN. 1967. Chromosome numbers in Compositae. VI. Senecioneae. II. Am. Jour. Bot. 54: 205-213.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type923 records

Wild obs. + sensor543

Museum / vouchered380

Origin

Native2

Range

Area of Occupancy AOO1 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 312≤1 km 60≤10 km 20>10 km 10

402 georeferenced · 141 without coordinates

Open the mapobservation + sensor543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 5≤1 km 128≤10 km 99>10 km 3

235 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence380

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow, US	70
Missoula, US	43
Claremont, US	33
Bronx, US	17
WTUlocation not on record	16
Davis, US	15
Bozeman, US	13
Pullman, US	13
US	12
Santa Barbara, US	11
Corvallis, US	11
Riverside, US	11
Boise, US	8
Caldwell, US	7
CASlocation not on record	7
Angwin, US	4
San Diego, US	3
Arcata, US	3
Northridge, US	3
Pocatello, US	2
Wuzhou, CN	2
Denver, US	2
Los Angeles, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Vancouver, CA	1
Pittsburg, US	1
New Haven, US	1
Canadian Department of Agriculturelocation not on record	1
Stockholm, SE	1
San Jose, US	1
Orem, US	1
Provo, US	1
Chongqing Museumlocation not on record	1
INFlocation not on record	1
Emporia, US	1
San Francisco, US	1
St. Paul, US	1
Durango, US	1
Logan, US	1

40 institutions · 326 of 380 vouchered records shown · 54 without an institution code

09Environmental DNA4 detections

Where the DNA of Hulsea algida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.