Hullsia argillicola

P.S.Short · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hullsia

At a glance

Occurrence records49

Data sources7

Biological traits9

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Hullsia argillicola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility49 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF49 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Hullsia is a genus of flowering plants in the family Asteraceae. It only contains one species, Hullsia argillicola. Hullsia range in Australia It is native to Australia, mainly the states of Northern Territory and Western Australia, and it grows on heavy clay soils. Located in regions that flood frequently, such as plains, paddocks and swamps.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology3

Plant height1 m

Plant height max1 m

Seed mass0.777 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hullsia argillicola has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJX564732.1 ↗699 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACATGTTATAACAACCATGCCAG …

Hullsia argillicola isolate ASL519 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type49 records

Wild obs. + sensor2

Museum / vouchered47

Origin

Native8

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 11≤1 km 4≤10 km 17

32 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	22
Kensington, AU	4
Museo Entomologico de Leonlocation not on record	4
Adelaide, AU	4
Brisbane, AU	3
Mount Annan, AU	3
Canberra, AU	3
Stockholm, SE	2
Kew, GB	2

9 institutions · 47 of 47 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Hullsia argillicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)