Hugonia mystax

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Linaceae/Hugonia

At a glance

Occurrence records69

Data sources6

Biological traits12

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Hugonia mystax's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Hugonia mystax est une espèce de plantes à fleurs de la famille des Linaceae. C'est un arbuste grimpant que l'on trouve principalement dans les forêts sèches du sous-continent indien et du Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Leaf size1 510 mm²

Life cycle & reproduction3

Deciduousnessevergreen

Life formscrambling shrub or tree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberobligatory

Growth formclimber

Woodinesswoody

Physiology & chemistry4

Leaf C:N ratio33.42 g/g

Leaf dry-matter content (LDMC)438 mg/g

Leaf n26.2 mg/g

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hugonia mystax has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLHM544055.1 ↗637 bpSri Lanka

ACGT

TATAAATTAACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCAGGAGTTCCG …

Hugonia mystax ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor50

Museum / vouchered19

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 20≤1 km 11≤10 km 3>10 km 2

36 georeferenced · 14 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 15

15 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	16
South Kensington, GB	1

2 institutions · 17 of 19 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Hugonia mystax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.7–25.7

Seasonal swing summer↔winter3.80 °C

Max temp (day)29.7 °C

Min temp (night)22.1 °C

Precipitation130 mm/mo

Air humidity64.2 %

Moisture balance-47.1 mm/mo

Vapour deficit1,194 Pa

Wind speed5.60 m/s

Cloud cover40.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)