Hudsonia ericoides

Plantae/Tracheophyta/Magnoliopsida/Malvales/Cistaceae/Hudsonia

At a glance

Occurrence records1 461

Data sources6

Biological traits12

DNA specimens9

eDNA detections1

Sources6 archives

Databases and archives Hudsonia ericoides's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 461 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF1 461 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI9 specimens

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.231 mg

Seed mass max0.23 mg

Seed mass min0.23 mg

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub

Woodinesswoody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hudsonia ericoides has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences1

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMG248925.1 ↗512 bpCanada · 2003

ACGT

AAGTGTTGGATTCAAAGCTGGTGTGAAAGAGTATAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGC …

Hudsonia ericoides voucher CCDB-24799-D05 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1rbcLaITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 461 records

Wild obs. + sensor1 094

Museum / vouchered367

Range

Area of Occupancy AOO2 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 637≤1 km 102≤10 km 43>10 km 114

896 georeferenced · 198 without coordinates

Open the mapobservation + sensor1 094

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 5≤1 km 48≤10 km 220>10 km 41

314 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence367

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	134
University of New Hampshirelocation not on record	39
Burlington, US	32
Chongqing Museumlocation not on record	29
Bloomington, US	10
University of Stellenboschlocation not on record	7
Millersville, US	7
Montréal, CA	6
New Haven, US	5
Bangkok, TH	5
College Park, US	5
Philadelphia, US	5
Acadia Universitylocation not on record	5
Staten Island, US	4
Centre for Biodiversity Genomicslocation not on record	2
Paris, FR	2
Moscow State Universitylocation not on record	2
Columbia, US	2
Saint John, CA	2
Denver, US	2
Davenport, US	2
WTUlocation not on record	1
Long Beach, US	1
EL PASO, US	1
Dover, US	1
Pullman, US	1
Flagstaff, US	1
Pittsburg, US	1
Chicago, US	1
BAYLUlocation not on record	1
Brookings, US	1
New Brunswick, US	1
Dekalb, US	1
Riverside, US	1
BClocation not on record	1

35 institutions · 321 of 367 vouchered records shown · 46 without an institution code

09Environmental DNA1 detections

Where the DNA of Hudsonia ericoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 13.0–13.0

Seasonal swing summer↔winter22.9 °C

Max temp (day)16.2 °C

Min temp (night)10.5 °C

Precipitation101 mm/mo

Air humidity62.8 %

Moisture balance-15.1 mm/mo

Vapour deficit554 Pa

Wind speed2.50 m/s

Cloud cover47.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources6 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Record type1 461 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions26 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 461 records