Hoya wayetii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Hoya

At a glance

Occurrence records2

Data sources5

Biological traits2

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Hoya wayetii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

01Narrative

Hoya wayetii is a species of flowering plant in the genus Hoya native to the Philippines. Sometimes confused with Hoya kentiana or Hoya shepherdii, it has long, slender foliage that often has a red margin when exposed to sufficient sun. Like many others in its genus, it has a vining growth habit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formclimbing epiphyte or lithophyte

Habitat & environment1

Climatewet tropical

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hoya wayetii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMG649224.1 ↗235 bp

ACGT

CGCATTGCGTTGCCCCCCACCCTCGCCCCCAAAGGTCATGGTCCCAAGCTCTGGGGCAACCGTTTTCTTCCAGTGTTCCCTCGTGCCGAC …

Hoya wayetii voucher WT135 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Wild obs. + sensor1

Museum / vouchered1

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	1

1 institutions · 1 of 1 vouchered records shown