Hovea purpurea

Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Hovea

At a glance

Occurrence records495

Data sources8

Biological traits37

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Hovea purpurea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility495 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF495 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Hovea purpurea, commonly known as velvet hovea, is a flowering plant in the family Fabaceae. It is an upright shrub with narrow leaves, purple pea flowers and stems with matted hairs. It grows in New South Wales, Victoria and South Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length13.5 mm

Leaf length70 mm

Leaf length max70 mm

Leaf length min12 mm

Leaf width4 mm

Leaf width max17 mm

Leaf width min4 mm

Petiole length0.425 cm

Plant height3 m

Plant height max3 m

Seed length6.25 mm

Seed mass14.6 mg

Seed mass max14.6 mg

Seed mass min14.6 mg

Seed width4 mm

Life cycle & reproduction9

Dehiscencedehiscent

Dispersal typeanimal

Flowering endDec

Flowering startOct

Flowering timennnnnnnnyyyn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical narrowly_oblong

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hovea purpurea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAY386889.1 ↗1 527 bp

ACGT

ATGGAGGAATATCAAGTATATTTAGAACTAGATAGATCTCGCCAACAGGACTTCCTATACCCACTTATTTTTCGAGAGTATATTTATGGA …

Hovea purpurea maturase-like protein (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type495 records

Wild obs. + sensor306

Museum / vouchered187

Cultivated / captive2

Origin

Native39

Range

Area of Occupancy AOO1 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 263≤1 km 23≤10 km 13

299 georeferenced · 7 without coordinates

Open the mapobservation + sensor306

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 18≤1 km 63≤10 km 78>10 km 6

165 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence187

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	68
Museo Entomologico de Leonlocation not on record	38
Mount Annan, AU	36
Canberra, AU	11
Wollongong, AU	6
Armidale, AU	6
Hobart, AU	5
Brisbane, AU	5
Kew, GB	2
Stockholm, SE	1
Taipei, TW	1
Parkville, AU	1
Auckland, NZ	1
Canadian Department of Agriculturelocation not on record	1
Batemans Bay, AU	1
Cambridge University Herbariumlocation not on record	1
Palmerston, AU	1

17 institutions · 185 of 187 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hovea purpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)