Hovea linearis

(Sm.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Hovea

At a glance

Occurrence records4 762

Data sources9

Biological traits41

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Hovea linearis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 762 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Chemical compositionNPASS52 compounds

Occurrence & distributionGBIF4 762 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Fruit Hovea linearis (common hovea) is a slender shrub in the family Fabaceae, native to Australia. The upper leaves are narrow and long while the lower leaves are oval-shaped. Purple (or occasionally white) flowers are produced in the spring. The species occurs in Queensland, New South Wales, Victoria, Tasmania and South Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length8.5 mm

Leaf length50 mm

Leaf length max110 mm

Leaf length min30 mm

Leaf mass16.06 mg

Leaf mass per area132 g/m2

Leaf size128 mm²

Leaf width2.35 mm

Petiole length0.275 cm

Plant height1.2 m

⚠ sources differ — AusTraits: 1.2 m · TRY: 1 m

Plant height max1.2 m

Seed length4 mm

Seed mass14.39 mg

⚠ sources differ — TRY: 14.39 mg · AusTraits: 18.95 mg · GIFT: 13.24 mg

Seed mass max20.05 mg

Seed mass min6.44 mg

Seed width3 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering endSep

Flowering startJul

Flowering timennnnnnnyynnn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Reproductive maturity2.5 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical linear narrowly_oblong strap-shaped

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition52 compounds

Compounds documented for Hovea linearis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinolizidine alkaloids13

Onocerane triterpenoids4

Disaccharides1

Terpenoid alkaloids1

Pyridine alkaloids $ Quinolizidine alkaloids1

Documented compounds52 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Onocerin	present	NPASS
(-)-Lycopodine	present	NPASS
(1R,2R,10S,11R,13S,14R,15S)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecane-11,14-diol	present	NPASS
(1R,2R,10S,13R,14S,15R)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecan-14-ol	present	NPASS
(1R,2R,10S,13S,15S)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecan-11-one	present	NPASS
(1R,2S,10R,11S,13S,15S)-11-hydroxy-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecan-14-one	present	NPASS
(1R,2S,4aR,6S,8aS)-1-[2-[(1S,4aR,6S,8aR)-6-hydroxy-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]ethyl]-5,5,8a-trimethyl-1,2,3,4,4a,6,7,8-octahydronaphthalene-2,6-diol	present	NPASS
(1R,9S,10R,16R)-16-methyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadeca-2(7),3-dien-5-one	present	NPASS
(1R,9S,10R,16S)-16-methyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadec-2(7)-en-5-one	present	NPASS
(1R,9S,10R,16S)-16-methyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadeca-2(7),3-dien-5-one	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hovea linearis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF204694.1 ↗244 bp

ACGT

TCGAAGCCTCACAAGCAGTGCGACTCGCGAATTTGTTTGACTTGATCGGGGCGGGCGGGGTGCTCGACGCCTCGGTCCCCCCGGTGCCGG …

Hovea linearis internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hovea linearis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 762 records

Wild obs. + sensor4 449

Museum / vouchered295

Cultivated / captive2

Other16

Origin

Native100

Range

Area of Occupancy AOO11 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 3 893≤1 km 339≤10 km 109>10 km 18

4 359 georeferenced · 90 without coordinates

Open the mapobservation + sensor4 449

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 24≤1 km 62≤10 km 151>10 km 31

268 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence295

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	99
Museo Entomologico de Leonlocation not on record	47
Canberra, AU	45
Brisbane, AU	21
Wollongong, AU	17
Adelaide, AU	14
Armidale, AU	9
Kew, GB	7
Batemans Bay, AU	6
Hobart, AU	5
Parkville, AU	4
Smithfield, AU	4
James Cook Townsvillelocation not on record	3
LDlocation not on record	3
Kensington, AU	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Palmerston, AU	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Auckland, NZ	1
La Trobe Universitylocation not on record	1

21 institutions · 294 of 295 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hovea linearis

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Compound class profile5 classes

Documented compounds52 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 762 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 21 geolocated

Cultivated / Captivenot free-living

Record type4 762 records