Hovea acutifolia

A.Cunn. ex G.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Hovea

At a glance

Occurrence records2 012

Data sources10

Biological traits34

DNA specimens3

eDNA detections1

Sources10 archives

Databases and archives Hovea acutifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 012 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF2 012 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Hovea acutifolia, is a species of flowering plant in the family Fabaceae. It is an upright, small shrub with blue to purple pea flowers, dark green leaves and rusty coloured new growth. It grows in Queensland and New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length15 mm

Leaf length57.5 mm

Leaf length max70 mm

Leaf length min30 mm

Leaf width9.5 mm

Leaf width max12 mm

Leaf width min3 mm

Petiole length0.4 cm

Plant height5 m

Plant height max4 m

Seed length5 mm

Seed mass30.52 mg

⚠ sources differ — TRY: 30.52 mg · AusTraits: 28.65 mg · GIFT: 30.52 mg

Seed mass max30.52 mg

Seed mass min30.52 mg

Seed width3.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscencedehiscent

Flowering timennnnnnnnyyyn

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density738 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Hovea acutifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cholestane steroids $ Ergostane steroids2

Stigmastane steroids1

Oleanane triterpenoids1

Cholestane steroids $ Stigmastane steroids1

Quinolizidine alkaloids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Sparteine	present	LOTUS
(24S)-Ergost-4-en-3-one	present	NPASS
(3R,8S,9S,10R,13R,14S,17R)-17-((2R,5S)-5,6-dimethylheptan-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta(a)phenanthren-3-ol	present	NPASS
(4aS,6aR,6bS,8aR,12aR,14aS,14bR)-4,4,6a,6b,8a,11,11,14b-octamethyl-2,4a,5,6,7,8,9,10,12,12a,14,14a-dodecahydro-1H-picen-3-one	present	NPASS
methyl (1S,2R,3S,4R,5R,6S,8R,11R,12R,15S,16S,21R,22R,23R,24S)-3,4,23,24-tetraacetyloxy-22-(acetyloxymethyl)-11-hydroxy-2,5,15,21-tetramethyl-9,19-dimethylidene-7,20-dioxahexacyclo[13.9.0.02,12.05,11.06,8.016,22]tetracos-17-ene-6-carboxylate	present	NPASS
methyl (1S,2R,3S,4R,5R,6S,8R,11R,12R,15S,16S,21R,22R,23R,24S)-3,4,23,24-tetraacetyloxy-22-(acetyloxymethyl)-11-hydroxy-2,5,15,21-tetramethyl-9-methylidene-19-oxo-7,20-dioxahexacyclo[13.9.0.02,12.05,11.06,8.016,22]tetracos-17-ene-6-carboxylate	present	NPASS
Stigmasta-4-22-dien-3-one	present	NPASS
Stigmasterol	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hovea acutifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594254.1 ↗407 bpAustralia · 2011

ACGT

ACTCCTGACTATGAAACCAAAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCTGGGGTTCCGCCTGAAGAAGCAGTGCCG …

Hovea acutifolia voucher 600200001 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type2 012 records

Wild obs. + sensor1 325

Museum / vouchered436

Cultivated / captive5

Fossil1

Other245

Origin

Native80

Introduced2

Range

Area of Occupancy AOO3 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 800≤1 km 161≤10 km 38>10 km 61

1 060 georeferenced · 265 without coordinates

Open the mapobservation + sensor1 325

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 55≤1 km 56≤10 km 193>10 km 69

373 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence436

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 4

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	136
Museo Entomologico de Leonlocation not on record	112
Mount Annan, AU	82
Canberra, AU	53
Armidale, AU	22
Adelaide, AU	8
Kew, GB	7
LDlocation not on record	3
Stockholm, SE	2
Hobart, AU	2
Boise, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Auckland, NZ	1
University of Stellenboschlocation not on record	1
University of the Sunshine Coastlocation not on record	1

15 institutions · 432 of 436 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hovea acutifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.0 °C 25.0–25.0

Seasonal swing summer↔winter8.90 °C

Max temp (day)27.2 °C

Min temp (night)22.7 °C

Precipitation162 mm/mo

Air humidity60.8 %

Moisture balance-46.6 mm/mo

Vapour deficit1,235 Pa

Wind speed5.40 m/s

Cloud cover30.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hovea acutifolia

At a glance

Sources10 archives

Size & morphology15

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds8 total

At a glance

Record type2 012 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 012 records