Houstonia rosea

(Raf.) Terrell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Houstonia

At a glance

Occurrence records545

Data sources9

Biological traits10

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Houstonia rosea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility545 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF545 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Houstonia rosea, the rose bluet, is a North American plant species in the coffee family.Terrell, Edward Everett. 1986. Rhodora 88(855): 395, Houstonia roseaRafinesque, Constantine Samuel. 1817. Florula Ludoviciana, or, a Flora of the State of Louisiana, p 77, Hedyotis rosea It is a tiny plant only a few centimeters tall, with pink flowers. It is native to the south-central United States: Texas, Oklahoma, Arkansas, Louisiana, Mississippi, Alabama and southern Missouri.Kew World Checklist of Selected Plant FamiliesBiota of North America Program 2014 county distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsubshrub

Life spanannual

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Houstonia rosea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences7

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ012686.1 ↗206 bp

ACGT

GGAAGGATCATTGTCGAATCCTGCAAACCACCGCGAACACGTTAAATAAAACCTCGGGTGCTTGATGGCTTTCGCCTAACGGCCCCGAAC …

Houstonia rosea voucher S. Emery & M. Couvillon 2 (IND) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Houstonia rosea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · Cave1962

CCDB · Cave1962 — Lewis 1962a

n 71×CCDB · Cave1962

CCDB · Cave1962 — Lewis 1962a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.998 ↗

08Occurrence & distribution

Record type545 records

Wild obs. + sensor487

Museum / vouchered58

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 240≤1 km 20≤10 km 4>10 km 43

307 georeferenced · 180 without coordinates

Open the mapobservation + sensor487

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 11≤1 km 9≤10 km 2>10 km 3

25 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	8
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	8
Chapel Hill, US	6
Jena Microbial Resource Collectionlocation not on record	5
US	5
Little Rock, US	5
Jackson, US	3
Fayetteville, US	2
Austin, US	2
BAYLUlocation not on record	2
Tuscaloosa, US	1
Wuzhou, CN	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Emporia, US	1
University of Southern Mississippilocation not on record	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Chongqing Museumlocation not on record	1
Bloomington, US	1
AUAlocation not on record	1
Madison, US	1

21 institutions · 57 of 58 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Houstonia rosea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)