Houstonia procumbens

(Walter ex J.F.Gmel.) Standl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Houstonia

At a glance

Occurrence records2 922

Data sources10

Biological traits7

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Houstonia procumbens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 922 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF2 922 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Houstonia procumbens, the roundleaf bluet, is a perennial species in the family Rubiaceae. It is native to the southeastern United States: Louisiana, Mississippi, Alabama, Georgia, Florida and South Carolina. Its native habitats include disturbed sites, and moist, open, sandy areas. Flowers bloom March to October.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Houstonia procumbens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ012684.1 ↗207 bp

ACGT

GGAAGGATCATTGTCGAATCCTGCAAACCACCGTGAACACGTTATATAAAATCTCGGGTGCCTGATGGCAATTGCCTAACGGCCTCGAAT …

Houstonia procumbens voucher D. Church 95 (IND) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Houstonia procumbens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · Cave1962

CCDB · Cave1962 — Lewis 1962a

n 141×CCDB · Cave1962

CCDB · Cave1962 — Lewis 1962a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.000 ↗

08Occurrence & distribution

Record type2 922 records

Wild obs. + sensor2 602

Museum / vouchered320

Range

Area of Occupancy AOO6 816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 445≤1 km 306≤10 km 116>10 km 227

2 094 georeferenced · 508 without coordinates

Open the mapobservation + sensor2 602

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 13≤1 km 27≤10 km 41>10 km 13

94 georeferenced · 226 without coordinates

Open the institutions mapphysical evidence320

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	103
Jena Microbial Resource Collectionlocation not on record	42
Chapel Hill, US	30
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	16
GAlocation not on record	13
Jackson, US	12
Valdosta State Universitylocation not on record	12
Chongqing Museumlocation not on record	12
James F. Matthews Center for Biodiversity Studieslocation not on record	11
Tall Timbers Research Stationlocation not on record	8
Tuscaloosa, US	7
University of Stellenboschlocation not on record	7
Burlington, US	5
AUAlocation not on record	4
Columbia, US	3
University of Southern Mississippilocation not on record	3
US	3
Dekalb, US	2
Chadron, US	2
Bloomington, US	2
Tempe, US	2
Clemson, US	2
Florida Museum of Natural Historylocation not on record	1
San Angelo, US	1
Flagstaff, US	1
Bangkok, TH	1
Philadelphia, US	1
University of South Carolina Salkehatchielocation not on record	1

28 institutions · 307 of 320 vouchered records shown · 13 without an institution code

09Environmental DNA1 detections

Where the DNA of Houstonia procumbens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Houstonia procumbens

At a glance

Sources10 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 922 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 922 records