Houlletia brocklehurstiana

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Houlletia

At a glance

Occurrence records13

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Houlletia brocklehurstiana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF13 records

DNA & barcodingNCBIsequences

01Narrative

Houlletia brocklehurstiana is a species of orchid native to Brazil (from Rio de Janeiro to Paraná). It is the type species of the genus Houlletia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formpseudobulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Houlletia brocklehurstiana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKF660273.1 ↗1 419 bp

ACGT

ATATTTTGGCAACAAAACTTCCTCTATCCGCTACTCCTTCAGGAGTATATTTATTCACTTGCTCATTATCATAGCTTCAATAGTTTTATT …

Houlletia brocklehurstiana voucher M:Gerlach s.n. maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1

plant barcode

08Occurrence & distribution

Record type13 records

Wild obs. + sensor1

Museum / vouchered12

Origin

Native7

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
INMAlocation not on record	5
JBRJlocation not on record	3
Laboratorio de Ictiologialocation not on record	1
CEPLAClocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
South Kensington, GB	1

6 institutions · 12 of 12 vouchered records shown