Hosta sieboldiana

(Hook.) Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Hosta

At a glance

Occurrence records628

Data sources10

Biological traits15

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Hosta sieboldiana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility628 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS60 compounds

Occurrence & distributionGBIF628 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 60

01Narrative

Hosta sieboldiana, Siebold's plantain lily, is a species of hosta native to Japan. A putative variety, Hosta sieboldiana var. elegans (called the giant blue hosta), has gained the Royal Horticultural Society's Award of Garden Merit, as has a putative variety of its synonym; Hosta fortunei var. aureomarginata, the gold-edged plantain lily. The cultivars 'Blue Angel', 'Blue Mammoth', and 'Olive Bailey Langdon' have also gained the RHS Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.65 mg

Seed mass max3.94 mg

Seed mass min3.28 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition60 compounds

Compounds documented for Hosta sieboldiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Quinoline alkaloids23

Isoquinoline alkaloids4

Stigmastane steroids3

Simple coumarins3

Aporphine alkaloids $ Isoquinoline alkaloids2

Documented compounds60 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	NPASS
(+)-Simulanol	present	NPASS
(-)-Balanophonin	present	NPASS
(-)-Linalyl acetate	present	NPASS
(-)-Syringaresinol	present	NPASS
(2R)-2-[(3R)-3-hydroxy-4-methylpentyl]-2,6-dimethylpyrano[3,2-c]quinolin-5-one	present	NPASS
(2R)-2-[(E)-4-hydroperoxy-4-methylpent-2-enyl]-2,6-dimethylpyrano[3,2-c]quinolin-5-one	present	NPASS
(2S)-2,6-dimethyl-2-(4-methyl-3-oxopentyl)pyrano[3,2-c]quinolin-5-one	present	NPASS
(2S)-2,6-dimethyl-2-(4-methylpent-3-enyl)pyrano[3,2-c]quinolin-5-one	present	NPASS
(2S)-2-[(E)-4-hydroxy-4-methylpent-2-enyl]-2,6-dimethylpyrano[3,2-c]quinolin-5-one	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hosta sieboldiana has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC800084.1 ↗810 bpJapan · 2011

ACGT

TATCTTTAGAGGAAGGAGATTGTAGTCTGGAGGGCGTCAGCGAACCCGTTGACGCGCCCGGCGGCGGCCGGACGGGGGGCGGAGCTCGCC …

Hosta sieboldiana P2544 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hosta sieboldiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidydiploid inferred

Chromosome records60–602n range60median60mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 609×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants +1

CCDB · book-ipcn66 — Kaneko Hl66

CCDB · book-ipcn67-71 — KANEKO, K., & F. MAEKAWA. 1968. Chromosome numbers of 26 species of Hosta. Jap. J. Bot. 43: 200-205.

CCDB · book-ipcn67-71 — KANEKO, K. 1969. Cytological studies on some species of Hosta V. Karyotypes of li plantaqinea, li tokudama, li kikutii~ kikutii var. yakusimensis, li crispula and li lonqipes. Bot. Mag. (Tokyo) 82: 253-262.

CCDB · book-atlas-flowering-plants — Yasui 1935

CCDB · book-atlas-flowering-plants

CCDB · kew — Zonneveld BJM, Van Iren F. 2001. Genome size and pollen viability as taxonomic criteria: Application to the genus Hosta. Plant Biology 3: 176-185.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type628 records

Wild obs. + sensor311

Museum / vouchered260

Cultivated / captive57

Origin

Introduced40

Range

Area of Occupancy AOO1 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 185≤1 km 50≤10 km 4>10 km 12

251 georeferenced · 60 without coordinates

Open the mapobservation + sensor311

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 57≤1 km 13≤10 km 1

71 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence260

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy13% within 1 km

≤1 km 6≤10 km 40

46 georeferenced · 11 without coordinates

Open the mapnot free-living57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KMNlocation not on record	51
Nagatoro-machi, Chichibu-gun, JP	47
Bando, JP	39
Tomioka, JP	28
Fukushima Universitylocation not on record	18
Sagamihara, JP	8
Otaru, JP	7
KOMlocation not on record	5
Sanda, JP	4
SLU Artdatabankenlocation not on record	4
Olocation not on record	4
Chongqing Museumlocation not on record	4
University of Stellenboschlocation not on record	4
Osaka, JP	3
Iwate Prefectural Museumlocation not on record	3
LDlocation not on record	3
Parthenon Tama History Museumlocation not on record	3
JP	2
Oskarshamn, SE	2
Akita Prefectural Museumlocation not on record	2
Toyota city nature sanctuarylocation not on record	2
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	2
DBF-NHMDlocation not on record	1
Nanjing, CN	1
Taipei, TW	1
Nagano City, JP	1
Henderson State Universitylocation not on record	1
Auckland, NZ	1
Ishikawa Museum of Natural Historylocation not on record	1
Trondheim, NO	1

30 institutions · 253 of 260 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)