Hosta lancifolia

(Thunb.) Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Hosta

At a glance

Occurrence records175

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Hosta lancifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility175 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources12 traits

Occurrence & distributionGBIF175 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT9.7 Gbp

02Traits & measurements

SourcesGIFT

Size & morphology2

Plant height max0.4 m

Plant height min0.3 m

Life cycle & reproduction3

Flowering endAug

Flowering startAug

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTdunes, forest edges, mountains, rivers, stony places

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hosta lancifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKAB017317.1 ↗1 139 bp

ACGT

TTGGTTATGACAATAAATCTAGTTTAGCACTTGTAAAACGCCTAATTACTCGAATCTATCAACAGAATTATTTGATTTCTTCGGTTAATG …

Hosta lancifolia chloroplast matK gene for maturase, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hosta lancifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size9 725 361 734 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hosta lancifolia9.73 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidy2× diploid · measured

Chromosome records60–602n range60median60mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 6010×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +5

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytology of species of Hemerocallideae from south India. Cytologia 55: 335–338.

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.

CCDB · book-ipcn66 — Kaneko 1966

CCDB · book-ipcn67-71 — KANEKO, K., & F. MAEKAWA. 1968. Chromosome numbers of 26 species of Hosta. Jap. J. Bot. 43: 200-205.

CCDB · book-ipcn67-71 — MAEKAWA, F., & K. KANEKO. 1968. Evolution of karyotype in Hosta. Jap J. Bot. 43: 132-140.

CCDB · eflora

CCDB · book-fedorov — Sharma A. K., Chat terji A. K. 1958

CCDB · book-atlas-flowering-plants — Akemine 1935

CCDB · Cave1958 — Sharma & Chatt. 1958

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type175 records

Wild obs. + sensor93

Museum / vouchered74

Cultivated / captive8

Origin

Introduced5

Range

Area of Occupancy AOO572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 64≤1 km 12≤10 km 3>10 km 7

86 georeferenced · 7 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 15≤1 km 13≤10 km 23>10 km 2

53 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence74

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 3 without coordinates

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	9
Philadelphia, US	8
LDlocation not on record	8
Allentown, US	7
Chongqing Museumlocation not on record	5
Olocation not on record	3
University of Stellenboschlocation not on record	3
Helsinki, FI	3
Oskarshamn, SE	2
Tartu, EE	2
Durham, US	2
Vancouver, CA	1
BRNUlocation not on record	1
Bronx, US	1
Bergen, NO	1
Dekalb, US	1
Québec, CA	1
Denver, US	1
Adam Mickiewicz University in Poznańlocation not on record	1
KMNlocation not on record	1
Appalachian State Universitylocation not on record	1
Burlington, US	1
Uppsala, SE	1
Henderson State Universitylocation not on record	1

24 institutions · 65 of 74 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)