Hosta clausa

Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Hosta

At a glance

Occurrence records80

Data sources7

Biological traits16

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Hosta clausa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Occurrence & distributionGBIF80 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 90

01Narrative

Hosta clausa is a species of the genus Hosta.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology5

Leaf length125 mm

Leaf length max150 mm

Leaf length min100 mm

Leaf width max60 mm

Leaf width min20 mm

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max420 m

Elevation mean420 m

Elevation min420 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hosta clausa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOL628765.1 ↗156 567 bp

ACGT

GGCGGAGAAGGGAGCTATACCCAATATTTTTATTTTGGAAGATATTGGGTATAGCCCCCTCAACGATTCTTATTCTTAATACATTAAGAC …

Hosta clausa var. geumgangensis chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Hosta clausa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 90 n = 45

Ploidypolyploid inferred

Chromosome records48–962n range90median90mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 906×CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants · CCDB · kew

CCDB · book-ipcn67-71 — KANEKO, K. 1968. Cytological studies on some species of Hosta III. Karyotypes of H. calusa, var. normalis and B ventricosa. Bot. Mag. (Tokyol~396-403.

CCDB · book-ipcn67-71 — KUZMANOV, B., & s. KOZUHAROV. 1969. Chromosome numbers of flowering plants in Bulgaria. 2. Izv. Bot. Inst. (Sofia) 19: 109-115.

CCDB · book-ipcn67-71 — KANEKO, K., & F. MAEKAWA. 1968. Chromosome numbers of 26 species of Hosta. Jap. J. Bot. 43: 200-205.

CCDB · book-atlas-flowering-plants — Yasui 1935 "

CCDB · kew — Zonneveld BJM, Van Iren F. 2001. Genome size and pollen viability as taxonomic criteria: Application to the genus Hosta. Plant Biology 3: 176-185.

2n 604×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · kew

CCDB · ipcn-api-dl — LEE, Y. N. 1967. Chromosome numbers of flowering plants in Korea. J. Korean Res. Inst. Ewha Women's Univ. 11: 455–478.

CCDB · ipcn-api-dl — Chung, M. G., J. L. Hamrick, J. S. B. Jones & G. S. Derda. 1991. Isozyme variation within and among populations of Hosta (Liliaceae) in Korea. Syst. Bot. 16: 667.

CCDB · book-ipcn67-71 — LEE, Y.N. 1967. Chromosome numbers of flowering plants in Korea (1) J. Korean Cult. Res. Inst. 11: 455-478.

CCDB · kew — Zonneveld BJM, Van Iren F. 2001. Genome size and pollen viability as taxonomic criteria: Application to the genus Hosta. Plant Biology 3: 176-185.

2n 481×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — LEE, Y.N. 1973. A taxonomic study of two Korean taxa, Hosta clausa Nakai and Hosta clausa Nakai var. normalis F. Maekawa. J. Korean Res. Inst. Better Living 10: 37-41.

2n 961×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — LEE, Y.N. 1973. A taxonomic study of two Korean taxa, Hosta clausa Nakai and Hosta clausa Nakai var. normalis F. Maekawa. J. Korean Res. Inst. Better Living 10: 37-41.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type80 records

Wild obs. + sensor39

Museum / vouchered41

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9

9 georeferenced · 30 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Servico de Microbiologia e Imunologialocation not on record	12
DMZ botanic gardenlocation not on record	10
KR	4
Herbarium of the Department of Botany, University of Tokyolocation not on record	3
Kyoto Universitylocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	1

6 institutions · 32 of 41 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)