Horsfieldia kingii

(Hook.fil.) Warb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Myristicaceae/Horsfieldia

At a glance

Occurrence records22

Data sources7

Biological traits26

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Horsfieldia kingii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Horsfieldia kingii is a dioecious tree of the family Myristicaceae. It grows up to 20 m tallChaudhuri, AB (1993) Forest Plants of Eastern India APH Publishing p. 434 and has large seeds that are dispersed by frugivores such as hornbills and imperial pigeons.Aparajita Datta & Rawat, GS (2008) Dispersal modes and spatial patterns of tree species in a tropical forest in Arunachal Pradesh, northeast India, Mongabay.com Open Access Journal - Tropical Conservation Science Vol. 1(3):163-185 PDF The fruiting period is from February to May.Nandini Velho (2008) The effect of terrestrial rodents on seed fate of hornbill-dispersed plants in Pakke Tiger Reserve, Unpublished MSc Thesis Manipal University. pp. 81 PDF The fruit is an arillate capsule and is bi-coloured. The plant is referred to as ramtamul in Assamese language and is sometimes used as a substitute for betelnut. However, they could be mildly intoxicating to humans. The leaves form a part of the diet of the endangered capped langur.Kumar, A & Solanki, GS (2008) Population Status and Conservation of Capped Langurs (Trachypithecus pileatus) in and around Pakke Wildlife Sanctuary, Arunachal Pradesh, India. Primate Conservation (23): 97–105 PDF

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length42.5 mm

Fruit length max45 mm

Fruit length min40 mm

Leaf length415 mm

Leaf length max550 mm

Leaf length min280 mm

Leaf width185 mm

Leaf width max220 mm

Leaf width min150 mm

Plant height8 m

⚠ sources differ — GIFT: 8 m · TRY: 15 m

Plant height max10 m

Plant height min6 m

Seed volume7 600 mm³

Seed volume max7 600 mm³

Seed volume min7 600 mm³

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment8

Climatewet tropical

Climberself-supporting

Elevation max1 200 m

Elevation mean1 000 m

Elevation min800 m

Fruit fleshinessdry

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Horsfieldia kingii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOP863234.1 ↗492 bpIndia · 2018

ACGT

TTATTATACTCCTGAATATGCAACCAAAGATACTGATATCTTAGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGC …

Horsfieldia kingii voucher NEIST 1614 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL2

plant barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor10

Museum / vouchered12

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 3≤1 km 3≤10 km 1

7 georeferenced · 3 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	3
Beijing, CN	1
Kunming, CN	1
Vietnam National Museum of Naturelocation not on record	1
BMlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1

6 institutions · 8 of 12 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Horsfieldia kingii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 15.8–15.8

Seasonal swing summer↔winter17.7 °C

Max temp (day)18.5 °C

Min temp (night)11.9 °C

Precipitation378 mm/mo

Air humidity70.4 %

Moisture balance284 mm/mo

Vapour deficit529 Pa

Wind speed3.70 m/s

Cloud cover53.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)