Horsfieldia irya

(Gaertn.) Warb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Myristicaceae/Horsfieldia

At a glance

Occurrence records343

Data sources11

Biological traits19

DNA specimens8

eDNA detections4

Sources11 archives

Databases and archives Horsfieldia irya's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility343 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS · NPASS38 compounds

Occurrence & distributionGBIF343 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Horsfieldia irya, Baratang, Andaman and Nicobar Islands, India Horsfieldia irya is a species of plant in the family Myristicaceae. It is found in Burma, India, Malaysia, Papua New Guinea, Singapore, Solomon Islands, Sri Lanka, Thailand, and Vietnam. The plant is a dioecious tree that grows to about 8–10 m high. Its leaves are thick, elliptical and up to 25 cm long, while its panicles are short and have rust hairs. The plant's young leaves are consumed as vegetables, or used an ingredients such as for cooking. In Vietnam it is used in a Bánh tráng Trảng Bàng rice paper dish.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height40 m

Plant height max25 m

Seed volume1 400 mm³

Seed volume max1 400 mm³

Seed volume min1 400 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Self fertilizationabsent

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density387 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition38 compounds

Compounds documented for Horsfieldia irya across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pseudoguaiane sesquiterpenoids13

Guaiane sesquiterpenoids4

Acyclic monoterpenoids4

Furofuranoid lignans3

Chromones2

Documented compounds38 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Asarinin	present	LOTUS
(2R,3S)-2,3-bis(1,3-benzodioxol-5-ylmethyl)butane-1,4-diol	present	LOTUS
(3aR,5aR,7R,8S,8aR,9aR)-7,8-dihydroxy-5,8-dimethyl-1-methylidene-5a,6,7,8a,9,9a-hexahydro-3aH-azuleno[6,5-b]furan-2-one	present	NPASS
(3aR,5aR,8R,8aR,9aR)-5,8-dimethyl-1-methylidene-8-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-5a,6,7,8a,9,9a-hexahydro-3aH-azuleno[6,5-b]furan-2-one	present	NPASS
(8R)-8-hydroxy-2-(6-phenylhexyl)-5,6,7,8-tetrahydrochromen-4-one	present	LOTUS
(8R)-8-hydroxy-2-nonyl-5,6,7,8-tetrahydrochromen-4-one	present	LOTUS
5,7-Dihydroxy-2-(6-phenylhexyl)chromen-4-one	present	LOTUS
5,7-Dihydroxy-2-Nonylchromen-4-One	present	LOTUS
[(2R,3S,4S,5R,6R)-3,4,5-trihydroxy-6-[(2R)-5-methyl-4-oxo-2-prop-1-en-2-ylhex-5-enoxy]oxan-2-yl]methyl acetate	present	NPASS
[(2R,3S,4S,5R,6R)-3,4,5-trihydroxy-6-[(2R,3E)-5-methyl-2-prop-1-en-2-ylhexa-3,5-dienoxy]oxan-2-yl]methyl acetate	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Horsfieldia irya has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences1

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJF738509.1 ↗294 bpPapua New Guinea · 2008

ACGT

CAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGCAGGGGCTGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAA …

Horsfieldia irya voucher PC1A0006 ribulose-1,5-bisphophate carboxylase oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type343 records

Wild obs. + sensor22

Museum / vouchered317

Other4

Range

Area of Occupancy AOO852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 6≤1 km 5≤10 km 2

13 georeferenced · 9 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 316 without coordinates

Open the institutions mapphysical evidence317

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	11
Saint Louis, US	7
Honolulu, US	6
St. Paul, US	6
Bronx, US	4
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Fort Worth, US	3
Cibinong, ID	2
Llocation not on record	1
Cincinnati, US	1
Xiamen, CN	1
Pondicherry, IN	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
Servico de Microbiologia e Imunologialocation not on record	1
Edinburgh, GB	1

15 institutions · 49 of 317 vouchered records shown · 268 without an institution code

09Environmental DNA4 detections

Where the DNA of Horsfieldia irya was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.3–25.8

Seasonal swing summer↔winter0.6 °C

Max temp (day)25.8 °C 25.8–28.2

Min temp (night)23.1 °C 23.1–23.9

Precipitation397 mm/mo 364–397

Air humidity75.3 % 70.5–75.3

Moisture balance267 mm/mo 222–267

Vapour deficit746 Pa 746–980

Wind speed2.20 m/s 1.20–2.20

Cloud cover61.9 % 61.9–63.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)