Horsfieldia australiana

S.T.Blake · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Myristicaceae/Horsfieldia

At a glance

Occurrence records723

Data sources7

Biological traits28

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Horsfieldia australiana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility723 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF723 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

هورسفلدية أسترالية هي نوع غير مؤكد من النباتات تتبع جنس الهورسفلدية من الفصيلة البسباسية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology9

Fruit length22 mm

Fruit width14 mm

Leaf length195 mm

Leaf width60 mm

Petiole length0.6 cm

Plant height10 m

⚠ sources differ — GIFT: 10 m · AusTraits: 22.5 m

Plant height min10 m

Seed length15 mm

Seed width11 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennnnnnnyyynn

Life formtree

Life spanperennial

Resprouting capacityresprouts

Self fertilizationabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Horsfieldia australiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496315.1 ↗564 bpAustralia · 2013

ACGT

CTAAAGCAAGGTTGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGCAACCAAAGATACTGATATCTTA …

Horsfieldia australiana isolate E22 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type723 records

Wild obs. + sensor415

Museum / vouchered283

Other25

Origin

Native10

Range

Area of Occupancy AOO1 708 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 106≤1 km 1>10 km 2

109 georeferenced · 306 without coordinates

Open the mapobservation + sensor415

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 24≤1 km 36≤10 km 121>10 km 10

191 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence283

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	106
Brisbane, AU	64
Palmerston, AU	44
Canberra, AU	16
Kew, GB	7
Museo Entomologico de Leonlocation not on record	6
Mount Annan, AU	5
Honolulu, US	4
John T. Waterhouse Herbariumlocation not on record	2
ASUlocation not on record	1
Adelaide, AU	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
BISHlocation not on record	1

14 institutions · 259 of 283 vouchered records shown · 23 without an institution code

09Environmental DNA1 detections

Where the DNA of Horsfieldia australiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)