Hornungia alpina

(L.) O.Appel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Hornungia

At a glance

Occurrence records7 811

Data sources10

Biological traits30

DNA specimens5

eDNA detections5

Sources10 archives

Databases and archives Hornungia alpina's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 811 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF7 811 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT176 Mbp

01Narrative

Hornungia alpina (also Hutchinsia alpina or Pritzelago alpina) is a flowering plant in the family Brassicaceae. It is native to the mountains of Southern and Central Europe, as far south as northern Spain (Pyrenees and Cordillera Cantábrica), central Italy and North Macedonia , and is sometimes grown as an ornamental plant in gardens .

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf size10.11 mm²

Plant height0.025 m

⚠ sources differ — GIFT: 0.025 m · LEDA: 0.025 m · TRY: 0.015 m

Plant height generative0.032 m

Plant height max0.1 m

Plant height min0.015 m

Seed length1.44 mm

Seed mass0.292 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewater

Flowering endAug

Flowering startMay

Life formsubshrub

Life spanperennial

Lifespan years7 years

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.005278717

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio11.62 g/g

Leaf c434 mg/g

Leaf dry-matter content (LDMC)163 mg/g

Leaf n37.34 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)4.98 mm²/mg

Other traits1

Diaspore typegenerative dispersule

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hornungia alpina has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections5

Countries6

The DNA barcodea real sequence read deposited for this species

ITSDQ249865.1 ↗611 bp

ACGT

TCGAATCCTGTTTAAAACAGAACGACCCGTGAACCAAAGATCATCACTCACGGTGGGCCGTTTTCTTAGCTGATCTCGTGCCTGCCCGAA …

Pritzelago alpina internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hornungia alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size176 040 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Hornungia alpina0.18 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidy2× diploid · measured

Chromosome records12–122n range12median12mode23records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1223×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · fl-europaea +6

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Kochjarová J., 1991: Karyological study of the Slovak flora XXIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 38 [1990]: 89-99.

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · slov-fl — Murín A. & Paclová L., 1986: Karyological study of the Slovak flora IX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 45-48.

CCDB · fl-europaea — Larsen, 1954a

CCDB · fl-europaea — Mattick, 1950

CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.

CCDB · ipcn-api-dl — Polatschek, A. 1983. Chromosomenzahlen und hinweise auf systematik und verbreitung van Brassicaceae-Arten aus Europa, Nordafrika, Asien und Australien. Phyton (Horn). 23: 127–139.

CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.

CCDB · ipcn-api-dl — Murín, A. & L. Paclová. 1986. Karyological study of the Slovak flora IX. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 45–48.

CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-

CCDB · brass — Murn

CCDB · brass — Manton

CCDB · brass — Skali?ska et al.

CCDB · brass — Larsen

CCDB · brass — Polatschek

CCDB · brass — Murn & Paclov

CCDB · brass — Lovka et al.

CCDB · kew — Lysák MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ. 2009. The dynamic ups and downs of genome size evolution in Brassicaceae. Molecular Biology and Evolution 26: 85-98.

CCDB · kew — Loureiro J, Castro M, Cerca de Oliveira J, Mota L, Torices R. 2013 Genome size variation and polyploidy incidence in the alpine flora from Spain. Annales del Jardin Botánico de Madrid 70: 39-47.

CCDB · Cave1956supp — Larsen 1954b

n 62×CCDB · brass

CCDB · brass — Tischler

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 811 records

Wild obs. + sensor7 261

Museum / vouchered450

Other100

Range

Area of Occupancy AOO8 864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 1 579≤1 km 456≤10 km 4 047>10 km 207

6 289 georeferenced · 972 without coordinates

Open the mapobservation + sensor7 261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 11≤1 km 50≤10 km 161>10 km 2

224 georeferenced · 226 without coordinates

Open the institutions mapphysical evidence450

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	124
Zürich, CH	66
Zürich, CH	41
Uniwersytet Wrocławskilocation not on record	40
LDlocation not on record	32
Wlocation not on record	20
Oskarshamn, SE	18
BDBClocation not on record	16
Monastir, TN	16
BClocation not on record	8
BIO-UNIPIlocation not on record	8
Porrentruy, CH	7
Mlocation not on record	5
BFLlocation not on record	5
Görlitz, DE	5
LfUlocation not on record	3
Tilburg, NL	3
Moscow State Universitylocation not on record	2
Martin-Luther-Universität Halle-Wittenberglocation not on record	2
Muséum Henri Lecoqlocation not on record	2
Bloomington, US	2
SLU Artdatabankenlocation not on record	2
Frankfurt am Main	1
Christchurch, NZ	1
Sion, CH	1
Provincia di Livornolocation not on record	1
BRNUlocation not on record	1
GZUlocation not on record	1
Helsinki, FI	1

29 institutions · 434 of 450 vouchered records shown · 16 without an institution code

09Environmental DNA5 detections

Where the DNA of Hornungia alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hornungia alpina

At a glance

Sources10 archives

Size & morphology7

Life cycle & reproduction8

Diet & foraging1

Habitat & environment7

Physiology & chemistry6

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type7 811 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type7 811 records