Hornstedtia scottiana

(F.Muell.) K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Hornstedtia

At a glance

Occurrence records340

Data sources7

Biological traits29

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Hornstedtia scottiana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility340 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF340 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Hornstedtia scottiana, common known as Scott's ginger, jiddo, or native cardamom, is a very large ginger (member of the family Zingiberaceae) native to Queensland, New Guinea and the Maluku Islands. Its fruits are eaten by the cassowary. It is also a food plant for the larval stages of the Banded Demon Butterfly.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length17.5 mm

Leaf length700 mm

Leaf size67 200 mm²

Leaf width105 mm

Plant height4 m

Seed length3.5 mm

Seed mass1.8 mg

Life cycle & reproduction8

Dispersal typeanimal

Flowering timeynnnnnyyyyyy

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Pollination syndromebee

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hornstedtia scottiana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF414480.1 ↗775 bp

ACGT

GATTGAATGGTCCGGTGAAGTGTTCGGATCGGGGGGACGGGGGTGGTTCGCCACCCGCGACGTCTTGAGAAGTCCATTGAACCTTATCAT …

Hornstedtia scottiana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type340 records

Wild obs. + sensor47

Museum / vouchered254

Cultivated / captive6

Other33

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 20≤1 km 7≤10 km 4

31 georeferenced · 16 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 15≤1 km 11≤10 km 37>10 km 18

81 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence254

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	76
Edinburgh, GB	62
Brisbane, AU	25
Kew, GB	10
Xiamen, CN	9
Museo Entomologico de Leonlocation not on record	5
Bronx, US	4
MeiseBGlocation not on record	3
Llocation not on record	2
Saint Louis, US	2
Copenhagen, DK	2
Cibinong, ID	2
South Kensington, GB	2
BISHlocation not on record	2
Canberra, AU	2
Clocation not on record	1
James Cook Townsvillelocation not on record	1
HAWlocation not on record	1
Australian Tropical Herbariumlocation not on record	1

19 institutions · 212 of 254 vouchered records shown · 41 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Hornstedtia scottiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 22.3–25.1

Seasonal swing summer↔winter12.8 °C

Max temp (day)28.0 °C 27.6–28.4

Min temp (night)19.0 °C 15.8–22.2

Precipitation334 mm/mo 79.2–588

Air humidity57.5 % 46.2–68.7

Moisture balance133 mm/mo -87.5–353

Vapour deficit1,275 Pa 995–1,554

Wind speed2.80 m/s 1.90–3.80

Cloud cover37.1 % 21.9–52.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)