Hordeum vulgare
speciesAt a glance
Occurrence records60 364
Data sources18
Biological traits142
DNA specimens96
eDNA detections43
Sources18 archives
Databases and archives Hordeum vulgare's data was compiled from.
WikipediaWikimedia Foundation22 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility60 364 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics96 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources142 traits
Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS6 285 compounds
Occurrence & distributionGBIF60 364 records
Environmental DNA3 datasets · 8 countries43 detections
DNA & barcodingBOLD · NCBI96 specimens
Genome at a glanceCCDB · GoaT · NCBI5 Gbp
01Narrative
Barley (Hordeum vulgare), a member of the grass family, is a major cereal grain grown in temperate climates globally. It was one of the first cultivated grains, particularly in Eurasia as early as 10,000 years ago. Globally 70% of barley production is used as animal fodder, while 30% as a source of fermentable material for beer and certain distilled beverages, and as a component of various foods. It is used in soups and stews, and in barley bread of various cultures. Barley grains are commonly made into malt in a traditional and ancient method of preparation. In 2017, barley was ranked fourth among grains in quantity produced (149 e6t) behind maize, rice and wheat.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology26
Inflorescence length max10 cm
Inflorescence length min4 cm
Leaf length200 mm
Leaf length max450 mm
Leaf length min200 mm
Leaf mass156 mg
Leaf size1 740 mm²
⚠ sources differ — LEDA: 1 740 mm² · GIFT: 2 322 mm²
Leaf width9.5 mm
⚠ sources differ — AusTraits: 9.5 mm · GIFT: 9 mm
Leaf width max12 mm
Leaf width min8 mm
Plant height0.856 m
⚠ sources differ — GIFT: 0.856 m · AusTraits: 1 m · LEDA: 0.965 m · USDA: 0.838 m · TRY: 0.73 m
Plant height generative0.752 m
Plant height max1.3 m
Plant height min0.4 m
Seed length9 mm
Seed length max9 mm
Seed length min9 mm
Seed mass41.58 mg
⚠ sources differ — TRY: 41.58 mg · LEDA: 40.91 mg · GIFT: 38.72 mg
Seed mass max42.3 mg
Seed mass min41.5 mg
Seed volume43 mm³
Seed volume max43 mm³
Seed volume min43 mm³
Seed width2.7 mm
Seed width max2.7 mm
Seed width min2.7 mm
Life cycle & reproduction36
After harvest regrowth rateModerate
Bloom periodLate Winter
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: epizoochor
Flower colouryellow
Flower conspicuousNo
Flowering endJun
Flowering startJun
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSpring
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityfire_killed
Seed number231
Seed spread rateModerate
Seedling vigorHigh
Sex typeandromonoecious
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodFall, Winter and Spring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 900 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: crops
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min11 in
Shape and orientationErect
Small grainYes
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceLow
C:N ratioLow
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min145 days
Leaf c417 mg/g
Leaf dry-matter content (LDMC)176 mg/g
Leaf n32.91 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max62 in
Precipitation min8.5 in
Protein potentialLow
Salinity toleranceHigh
Seed longevity index0
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min5.75 pH
Specific leaf area (SLA)35.25 mm²/mg
⚠ sources differ — TRY: 35.25 mm²/mg · LEDA: 0.04 mm²/mg · GIFT: 7.27 mm²/mg
Temperature min-15.5 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound13 800 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencespike
Shoot orientationascending
03Chemical composition6 285 compounds
Compounds documented for Hordeum vulgare across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingCereals and cereal products
Compound class profile5 classes
Aminoacids245
Glycerophospholipids57
Cinnamic acids and derivatives56
Flavones52
Unsaturated fatty acids46
Documented compounds6 285 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| WATER | 883,000 ppm | DukesPhytochem | |
| CARBOHYDRATES | 868,000 ppm | DukesPhytochem | |
| STARCH | 620,000 ppm | DukesPhytochem | |
| FIBER | 446,000 ppm | DukesPhytochem | |
| PROTEIN | 344,000 ppm | DukesPhytochem | |
| CELLULOSE | 322,000 ppm | DukesPhytochem | |
| PENTOSANS | 239,000 ppm | DukesPhytochem |
05DNA & barcoding96 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum vulgare has left across the world's sequence archives.
At a glance
DNA specimens96
Marker genes7
GenBank sequences10
eDNA detections43
Countries8
The DNA barcodea real sequence read deposited for this species
CGCCAAAACACGCTCCCAACCACCCTCTTCGGGAATTGGGATGCGGCATATGGTCCCTCGTCCTGCAAGGGGCGGTGGGCCGAAGATCGG …
Hordeum vulgare internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL4★rbcLa★ITS6★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Hordeum vulgare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 004 915 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hordeum vulgare5 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–702n range14median14mode72records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1467×GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl · CCDB · book-ipcn65 +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4632
CCDB · book-ipcn65 — Bowden 1965b
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Guan, Q. l., Y. f. Zhang & G. f. Mao. 1988. Comparative studies on the karyotypes in Hordeum bulbosum USSR, H. chilense and H. vulgare. Sci. Agric. Sin. 21: 32–34.
CCDB · ipcn-api-dl — Grover, I. S. & P. K. Malhi. 1988. Genotoxic effects of some organophosphorus pesticides III. In vivo chromosomal aberration bioassay in root meristems of Allium and Hordeum. Cytologia 53: 181–191.
CCDB · ipcn-api-dl — Makino, T. 1988. Production of reciprocal translocation lines and genetical analysis of tetravalent behavior in barley. Acta Radiobot. Genet. 7: 69–107.
CCDB · ipcn-api-dl — Chen, R. y. 1989. A further research of plant chromosome G-banding. Pp. 187--193 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Pershina, L. A., V. K. Shumny, L. I. Belova & O. M. Numerova. 1985. Interspecific and bigeneric hybridization of Hordeum geniculatum All. Citol. Genet. (Kiev). 19(6): 428–433.
CCDB · ipcn-api-dl — Bansal, Y. K. & S. Sen. 1983. Multi-stranded chromosomes in the differentiated tissue of Hordeum vulgare. Cytologia 48: 403–405.
CCDB · ipcn-api-dl — Chauhan, K. P. S. & M. S. Swaminathan. 1984. Cytogenetic effects of ageing in seeds. Genetica 64: 69–76.
CCDB · ipcn-api-dl — Jessop, C. M. & N. C. Subrahmanyam. 1984. Nucleolar number variation in Hordeum species, their haploids and interspecific hybrids. Genetica 64: 93–100.
CCDB · ipcn-api-dl — Akhaury, S. B. 1986. Comparative affects of gamma rays, ethyl methanesulphonate, ethylene imine, ethylene iodide in producing chromosomal aberrations in barley (Hordeum vulgare). Proc. Indian Sci. Congr. Assoc. 73(3–VI): 174–175.
CCDB · ipcn-api-dl — Ruiz, M. L. & A. M. Vázquez. 1982. Chromosome number evolution in stem derived calluses of Hordeum vulgare L. cultured in vitro. Protoplasma 111: 83–86.
CCDB · ipcn-api-dl — Zhang, Z. 1982. Chromosome observation of three Ranunculaceous genera in relation to their systematic positions. Acta Phytotax. Sin. 20: 402–408.
CCDB · ipcn-api-dl — Bhargava, Y. R. 1981. Light sensitivity of phytohormones and EMS treatments in Hordeum vulgare. Proc. Indian Sci. Congr. Assoc. 68 (Sect. VI): 79.
CCDB · ipcn-api-dl — Semenov, V. I. 1986. Vnutrikhromosomnaja topografija geterokhromatina u zlakovykh. Bjulleten' Glavnogo Botanic|5eskogo Sada 140: 68–73.
CCDB · ipcn-api-dl — Finch, R. A. 1983. Tissue-specific elimination of alternative whole parental genomes in one barley hybrid. Chromosoma 88: 386–393.
CCDB · ipcn-api-dl — Heslop-Harrison, J. S. & M. D. Bennett. 1983. Prediction and analysis of spatial order in haploid chromosome complements. Proc. Roy. Soc. London, Ser. B., Biol. Sci. 218: 211–223.
CCDB · ipcn-api-dl — Joshi, C. P. & P. K. Ranjekar. 1982. Visualization and distribution of heterochromatin in interphase nuclei of several plant species as revealed by a new Giemsa banding technique. Cytologia 47: 471–480.
CCDB · ipcn-api-dl — Kobrzy|3nski, M. 1989. Giemsa C-banding karyotypes in five varieties of Hordeum vulgare L. Acta Biol. Cracov., Ser. Bot. 30: 63–75.
CCDB · ipcn-api-dl — Heslop-Harrison, J. S., J. B. Smith & M. D. Bennett. 1988. The absence of the somatic association of centromeres of homologous chromosomes in grass mitotic metaphases. Chromosoma 96: 119–131.
CCDB · ipcn-api-dl — Zhang, Z. l. & L. Yu. 1990. Studies on chromosome Ag-banding in Hordeum vulgare. Acta Genet. Sin. 17: 168–172.
CCDB · ipcn-api-dl — Lu, B. r., J. Yan & J. l. Yang. 1990. Cytological observations on Triticeae materials from Xinjiang, Qinghai and Sichuan. Acta Bot. Yunnan. 12: 57–66.
CCDB · ipcn-api-dl — Schubert, I. & G. Kunzel. 1990. Position-dependent NOR activity in barley. Chromosoma 99: 352–359.
CCDB · ipcn-api-dl — Leitch, A. R., T. Schwarzacher, W. Mosgoller, M. D. Bennett & J. S. Heslop-Harrison. 1991. Parental genomes are separated throughout the cell cycle in a plant hybrid. Chromosoma 101: 206–213.
CCDB · ipcn-api-dl — Moinuddin, M., A. A. Vahidy & S. I. Ali. 1994. Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 784–791.
CCDB · ipcn-api-dl — Lehfer, H., W. Busch, R. Martin & R. G. Herrmann. 1993. Localization of the B-hordein locus on barley chromosomes using fluorescence in situ hybridization. Chromosoma 102: 428–432.
CCDB · ipcn-api-dl — Noguchi, J. & K. Fukui. 1995. Chromatin arrangements in intact interphase nuclei examined by laser confocal microscopy. J. Pl. Res. 108: 209–216.
CCDB · ipcn-api-dl — Ramesh, B. & T. Sharma. 1994. Intervarietal nuclear DNA variation in barley (Hordeum vulgare L.). Proc. Indian Natl. Sci. Acad., B 60: 83–86.
CCDB · ipcn-api-dl — Zhang, Y. f. & S. Yandua. 1996. Studies on N-banding pattern polymorphism of chromosomes in 92 cultivated barleys (Hordeum vulgare L.). Acta Agron. Sin. 22(4): 500–507.
CCDB · ipcn-api-dl — Ding, Y. & Y. c. Song. 1996. Analysis of G-band fluctuation and correspondence of G-banding patterns to chromomere patterns in barley. Acta Genet. Sin. 23(4): 268–275.
CCDB · ipcn-api-dl — Nicoloff, H., M. Anastassova-kristeva, G. Kunzel & R. Rieger. 1977. The behaviour of nucleolus organisers in structurally charged karyotypes of Barley. Chromosoma 62:103–109.
CCDB · ipcn-api-dl — Sadisivaiah, R. S., G. B. Collins & D. L. Davis. 1973. The effect of LSD on mitotic and meotic plant chromosomes. Chromosoma 44: 309–318.
CCDB · ipcn-api-dl — Sadisivaiah, R. S. & K. J. Kasha. 1971. Meiosis in haploid barley - An interpretation of nonhomologous chromosome associations. Chromosoma 35: 247–263.
CCDB · ipcn-api-dl — Schooler, A. B. & M. K. Anderson. 1980. Behavior of intergeneric hybrids between Hordeum vulgare L. (4x) and an Elymus mollis type. Cytologia 45: 157–162.
CCDB · ipcn-api-dl — Singh, R. J. & T. Tsuchiya. 1981. Ring chromosomes in barley (Hordeum vulgare L.). Chromosoma 82: 133–141.
CCDB · ipcn-api-dl — Subrahmanyam, N. C. & A. A. Azad. 1978. Trisomic analysis of ribosomal RNA cistron multiplicity in Barley (Hordeum vulgare L.). Chromosoma 69: 255–264.
CCDB · ipcn-api-dl — Yoshida, H. & H. Yamaguchi. 1973. Arrangement and association of somatic chromosomes induced by chloramphenicol in Barley. Chromosoma 43: 399–407.
CCDB · ipcn-api-dl — Grover, I. S. & P. S. Tyagi. 1980. Chromosomal aberrations induced by Thiodan in Barley. Sci. & Cult. 46: 227–229.
+23 more references
2n 283×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Chen, Y. r. & L. q. Wang. 1988. Morphological and cytogenetical studies on F1 of Hordeum vulgare L. and H. bulbosum L. J. Zhejiang Agric. 14(2): 142–148.
CCDB · ipcn-api-dl — Subrahmanyam, N. C. & K. J. Kasha. 1973. Selective chromosomal elimination during haploid formation in barley following interspecific hybridization. Chromosoma 42: 111–125.
2n 421×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Koba, T. 1993. Phytotechnology no Kokoromi (19). Agric. & Hort. 68: 515–523.
2n 701×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bildanova. 2004. Molecular study and C-banding of chromosome in common wheat alloplasmic lines obtained from backcross progeny of barley-wheat hybrids Hordeum vulagre L. (2n = 14) x Triticum aestivum L. (2n = 42) and differing in fertility. Genetika 40: 1668–1677.
n 713×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cave1956
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Baksi-Sanyal, S. & A. Sharma. 1979. Seed protein analysis and meiotic studies in cultivars of Indian barley. Proc. Indian Acad. Sci. 88B, pt. II: 79–86.
CCDB · ipcn-api-dl — Prasad, G. 1982. Chromosome configurations and sterility in intercrosses between homozygous interchanges involving same and different chromosomes in barley (Hordeum vulgare L.). Cytologia 47: 117–124.
CCDB · ipcn-api-dl — Vazquez, J. F. & E. Sanchez-Monge. 1987. Meiotic behaviour and fertility of three cultivars of barley (Hordeum vulgare L.) and their mutants induced by irradiation. Caryologia 40: 381–385.
CCDB · ipcn-api-dl — Heslop-Harrison, J. S. & M. D. Bennett. 1983. Prediction and analysis of spatial order in haploid chromosome complements. Proc. Roy. Soc. London, Ser. B., Biol. Sci. 218: 211–223.
CCDB · ipcn-api-dl — Schubert, I. & G. Kunzel. 1990. Position-dependent NOR activity in barley. Chromosoma 99: 352–359.
CCDB · ipcn-api-dl — Nicoloff, H., M. Anastassova-kristeva, G. Kunzel & R. Rieger. 1977. The behaviour of nucleolus organisers in structurally charged karyotypes of Barley. Chromosoma 62:103–109.
CCDB · ipcn-api-dl — Sadisivaiah, R. S., G. B. Collins & D. L. Davis. 1973. The effect of LSD on mitotic and meotic plant chromosomes. Chromosoma 44: 309–318.
CCDB · ipcn-api-dl — Yoshida, H. & H. Yamaguchi. 1973. Arrangement and association of somatic chromosomes induced by chloramphenicol in Barley. Chromosoma 43: 399–407.
CCDB · ipcn-api-dl — Grover, I. S. & P. S. Tyagi. 1980. Chromosomal aberrations induced by Thiodan in Barley. Sci. & Cult. 46: 227–229.
CCDB · ipcn-api-dl — Humphreys, M. W. 1978. Chromosome instability in Hordeum vulgare X H. bulbosum hybrids. Chromosoma 65: 301–307.
CCDB · book-ipcn75-78 — Sethi et al. 1977
CCDB · Cave1956 — Sharma b
n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
n 211×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 29
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.7% BUSCO
07Deep time~5.7 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.7 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type60 364 records
Wild obs. + sensor43 833
Museum / vouchered6 285
Cultivated / captive5 860
Fossil1
Other4 385
Origin
Native1 908
Introduced2 880
Range
Area of Occupancy AOO140 328 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 25 272≤1 km 3 428≤10 km 5 634>10 km 206
34 540 georeferenced · 9 293 without coordinates
Open the mapobservation + sensor43 833
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 253≤1 km 716≤10 km 963>10 km 101
2 033 georeferenced · 4 252 without coordinates
Open the institutions mapphysical evidence6 285
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy10% within 1 km
≤1 km 77≤10 km 408>10 km 264
749 georeferenced · 5 111 without coordinates
Open the mapnot free-living5 860
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions205 of 338 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| ESP004location not on record | 1 532 |
| Uniwersytet Wrocławskilocation not on record | 681 |
| CHE001location not on record | 614 |
| Paris, FR | 237 |
| AUT001location not on record | 142 |
| ROM007location not on record | 96 |
| South Kensington, GB | 83 |
| Saint Louis, US | 79 |
| SWE054location not on record | 77 |
| MeiseBGlocation not on record | 63 |
| UniKSlocation not on record | 59 |
| Karlsruhe, DE | 55 |
| LDlocation not on record | 53 |
| Moscow State Universitylocation not on record | 52 |
| Helsinki, FI | 52 |
| GBR165location not on record | 51 |
| Xining, CN | 51 |
| Beijing, CN | 45 |
| San Diego, US | 45 |
| Claremont, US | 40 |
| Olocation not on record | 38 |
| Trondheim, NO | 38 |
| Santa Barbara, US | 37 |
| AZE003location not on record | 36 |
| Jyväskylä, FI | 35 |
| Durango, MX | 35 |
| Görlitz, DE | 34 |
| HUN003location not on record | 32 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 28 |
| Provincia di Livornolocation not on record | 28 |
| Tartu, EE | 27 |
| San Luis Obispo, US | 26 |
| ASUlocation not on record | 24 |
| Kuopio, FI | 24 |
| TUR-Alocation not on record | 23 |
| US | 22 |
| Mexico City, MX | 22 |
| Istituto Agrario Castelnuovolocation not on record | 21 |
| Québec, CA | 21 |
| Philadelphia, US | 20 |
| Riverside, US | 20 |
| GBR016location not on record | 20 |
| College Park, US | 20 |
| Garðabær, IS | 19 |
| TROMlocation not on record | 19 |
| Kew, GB | 19 |
| Davis, US | 19 |
| Barcelona, ES | 18 |
| Chengdu, CN | 18 |
| Kunming, CN | 18 |
| 17 | |
| Ciudad de México, MX | 17 |
| Bronx, US | 17 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 16 |
| Sanda, JP | 15 |
| Oulu, FI | 15 |
| Burlington, US | 14 |
| Adelaide, AU | 13 |
| Uppsala, SE | 13 |
| València, ES | 13 |
| KMNlocation not on record | 13 |
| Montecillo, Texcoco, MX | 13 |
| Arcata, US | 13 |
| Flagstaff, US | 13 |
| Madison, US | 13 |
| SLU Artdatabankenlocation not on record | 13 |
| BDBClocation not on record | 13 |
| CICYTEXlocation not on record | 13 |
| GMBAlocation not on record | 12 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 12 |
| Oskarshamn, SE | 12 |
| Ann Arbor, US | 12 |
| ARM059location not on record | 12 |
| Turku, FI | 12 |
| Logan, US | 12 |
| Canberra, AU | 12 |
| Brisbane, AU | 11 |
| Zapopan, MX | 11 |
| Kochi, JP | 11 |
| BRNUlocation not on record | 10 |
| Guangzhou, CN | 10 |
| Pullman, US | 10 |
| Museo Entomologico de Leonlocation not on record | 10 |
| Chongqing Museumlocation not on record | 10 |
| IDElocation not on record | 10 |
| Mlocation not on record | 10 |
| Allentown, US | 10 |
| Sichuan Agricultural Universitylocation not on record | 10 |
| Taipei, TW | 10 |
| CHE100location not on record | 9 |
| DOI/NPS, Greenbelt Parklocation not on record | 9 |
| International Salmonella Centre (W.H.O.)location not on record | 9 |
| New Haven, US | 9 |
| MAlocation not on record | 9 |
| Entomological Society of Latvialocation not on record | 9 |
| Badajoz, ES | 9 |
| Austin, US | 9 |
| ROM023location not on record | 8 |
| Fort Worth, US | 8 |
| University of Stellenboschlocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Yangling, CN | 8 |
| WTUlocation not on record | 8 |
| Victoria, CA | 8 |
| Irvine, US | 8 |
| EL PASO, US | 8 |
| CASlocation not on record | 8 |
| Bloomington, US | 8 |
| Centro Internacional de Mejoramiento de Maíz y Trigolocation not on record | 8 |
| nlocation not on record | 7 |
| Denver, US | 7 |
| Wuzhou, CN | 7 |
| Philadelphia, US | 7 |
| Berlin, DE | 7 |
| TAIElocation not on record | 7 |
| Armidale, AU | 6 |
| Williamsburg, US | 6 |
| Long Beach, US | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Missoula, US | 6 |
| 云南省思茅市民族传统医药研究所location not on record | 6 |
| UChlocation not on record | 6 |
| Bergen, NO | 6 |
| Xiamen, CN | 6 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 6 |
| Chapingo, MX | 6 |
| Tsukuba, JP | 6 |
| Córdoba, ES | 6 |
| Millersville, US | 6 |
| Acadia Universitylocation not on record | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| Madrid, ES | 6 |
| Université Lavallocation not on record | 6 |
| Corvallis, US | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Severin-McDaniel Insect Collectionlocation not on record | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Kensington, AU | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Vancouver, CA | 5 |
| BFLlocation not on record | 5 |
| University of Winnipeglocation not on record | 5 |
| Guilin, CN | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Anchorage, US | 5 |
| Xinxiang, CN | 5 |
| Hobart, AU | 5 |
| Nagano City, JP | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| Santa Cruz, US | 4 |
| Granada, ES | 4 |
| Changsha, CN | 4 |
| Vitoria, ES | 4 |
| Los Angeles, US | 4 |
| Mount Annan, AU | 4 |
| Porrentruy, CH | 4 |
| Chapel Hill, US | 4 |
| Dresden, DE | 4 |
| Universidad de Caldas (UCaldas)location not on record | 4 |
| Tlalnepantla, MX | 4 |
| Tilburg, NL | 4 |
| Irkutsk State Universitylocation not on record | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Bangkok, TH | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Puebla, MX | 4 |
| University of New Hampshirelocation not on record | 4 |
| BClocation not on record | 3 |
| GB | 3 |
| Porvoo, FI | 3 |
| Toronto, CA | 3 |
| KR | 3 |
| Knoxville, US | 3 |
| Northridge, US | 3 |
| San Bernardino, US | 3 |
| Rishon Le Zion, IL | 3 |
| Phoenix, US | 3 |
| La Paz, MX | 3 |
| Wuhan, CN | 3 |
| ENTClocation not on record | 3 |
| Boise, US | 3 |
| Zürich, CH | 3 |
| Torreón, MX | 3 |
| Salzburg, AT | 3 |
| CJBGlocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Auckland, NZ | 3 |
| Chicago, US | 3 |
| Frankfurt am Main | 3 |
| GZUlocation not on record | 3 |
| Mexico City, MX | 3 |
| St. Paul, US | 3 |
| SIHUlocation not on record | 3 |
| Centre for Biodiversity Genomicslocation not on record | 3 |
| Orem, US | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Angwin, US | 2 |
| Taipei, TW | 2 |
| Green Bay, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Miami, US | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Bozeman, US | 2 |
| Moscow, US | 2 |
| Córdoba, AR | 2 |
| Davenport, US | 2 |
| Fayetteville, US | 2 |
| KURAlocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| USFSlocation not on record | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Yaoundé, CM | 2 |
| Chengdu, CN | 2 |
| Stockholm, SE | 2 |
| Albuquerque, US | 2 |
| Tallinn, EE | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Tacoma, US | 2 |
| Catalina Island Conservancylocation not on record | 2 |
| Tokushima, JP | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Jaén, ES | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Chengdu, CN | 2 |
| Aarhus, DK | 2 |
| Pocatello, US | 2 |
| PUC-RSlocation not on record | 2 |
| Montréal, CA | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| UIBlocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| Zacatecas, MX | 2 |
| Toluca, MX | 2 |
| Tampa, US | 2 |
| UTPLlocation not on record | 2 |
| Ensenada, MX | 2 |
| Saint John, CA | 2 |
| Salamanca, ES | 2 |
| Lubbock, US | 2 |
| Alicante, ES | 2 |
| Nishihara, JP | 2 |
| La Paz, BO | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| Clemson, US | 2 |
| Bratislava, SK | 2 |
| Ciudad Juárez, MX | 2 |
| Pamplona, ES | 2 |
| Hazara Universitylocation not on record | 1 |
| California Academy of Scienceslocation not on record | 1 |
| Nanjing, CN | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Morelia, MX | 1 |
| US | 1 |
| Bourges, FR | 1 |
| Bando, JP | 1 |
| Sendai, JP | 1 |
| Shenzhen, CN | 1 |
| Nanjing, CN | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| BAYLUlocation not on record | 1 |
| Smithfield, AU | 1 |
| Pamplona, ES | 1 |
| Cenargenlocation not on record | 1 |
| Palmerston, AU | 1 |
| Sagamihara, JP | 1 |
| Mexico City, MX | 1 |
| Henderson, US | 1 |
| Tuscaloosa, US | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| ifplocation not on record | 1 |
| ESP003location not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Cape Town, ZA | 1 |
| Fukushima Universitylocation not on record | 1 |
| Brasília, BR | 1 |
| Awka, NG | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Oswego, US | 1 |
| KOMlocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| nbflocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Cheney, US | 1 |
| Chiba, JP | 1 |
| US | 1 |
| Taipei, TW | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Ischia Marine Centrelocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Christchurch, NZ | 1 |
| BSBIlocation not on record | 1 |
| Wlocation not on record | 1 |
| Otaru, JP | 1 |
| Fairfax, US | 1 |
| Frauenfeld, CH | 1 |
| Cape Town, ZA | 1 |
| Ciudad de México, MX | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| JBSlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Riobamba, EC | 1 |
| Tromso University Museumlocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Brussel, BE | 1 |
| AZE015location not on record | 1 |
| BGR001location not on record | 1 |
| Whitewater, US | 1 |
| Zürich, CH | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| PRClocation not on record | 1 |
| Brookings, US | 1 |
| Wellington, NZ | 1 |
| Joondalup, AU | 1 |
| Jackson, US | 1 |
| Firenze, IT | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Nijmegen, NL | 1 |
| San Jose, US | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| IFR-DNFlocation not on record | 1 |
| Durango, US | 1 |
| Valparaíso, CL | 1 |
| Palmerston North, NZ | 1 |
| South China Normal Universitylocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Winterthur, CH | 1 |
| Dekalb, US | 1 |
338 institutions · 6 105 of 6 285 vouchered records shown · 126 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA43 detections
Where the DNA of Hordeum vulgare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys3
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map8 countries0
In railway ballast behind elevator in silty …NeotropicRoadside.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.4 °C 9.40–24.7
Seasonal swing summer↔winter26.4 °C
Max temp (day)25.7 °C 14.2–30.2
Min temp (night)16.1 °C 3.10–18.4
Precipitation92.0 mm/mo 13.8–167
Air humidity57.6 % 45.7–64.0
Moisture balance-40.2 mm/mo -164–14.6
Vapour deficit1,015 Pa 574–1,642
Wind speed4.50 m/s 2.40–4.80
Cloud cover36.6 % 24.1–41.9
CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.