Hordeum secalinum
Schreb. · speciesAt a glance
Occurrence records56 629
Data sources11
Biological traits49
DNA specimens25
eDNA detections15
Sources11 archives
Databases and archives Hordeum secalinum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility56 629 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics25 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources49 traits
Occurrence & distributionGBIF56 629 records
Environmental DNA1 datasets · 4 countries15 detections
DNA & barcodingBOLD · NCBI25 specimens
Genome at a glanceCCDB · GoaT10.4 Gbp
01Narrative
La segale selvatica è una pianta angiosperma monocotiledone appartenente alla famiglia delle Poacee.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology20
Leaf length105 mm
Leaf length max70 mm
Leaf mass14.26 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 473 mm² · GIFT: 473 mm²
Leaf width3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height0.338 m
⚠ sources differ — GIFT: 0.338 m · AusTraits: 0.7 m · LEDA: 0.325 m · TRY: 0.7 m
Plant height generative0.45 m
Plant height max0.8 m
Plant height min0.3 m
Seed length5 mm
Seed length max5 mm
Seed length min5 mm
Seed mass4.19 mg
⚠ sources differ — TRY: 4.19 mg · LEDA: 3.65 mg · GIFT: 3.84 mg
Seed mass max4 mg
Seed mass min4 mg
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction13
Deciduousnessdeciduous
Dispersal typeanimal
Flowering endAug
Flowering startMay
Life formperennial
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number17.5
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: grass
Habitat GIFTLowland
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)240 mg/g
Leaf n50 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)31.79 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding25 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum secalinum has left across the world's sequence archives.
At a glance
DNA specimens25
Marker genes4
GenBank sequences10
eDNA detections15
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCAAGGGCACGCCTGCCTGGGCGTCACGCCAA …
Hordeum secalinum voucher NMW3296 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL1★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hordeum secalinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size10 361 910 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hordeum secalinum10.36 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–422n range28median28mode24records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2817×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · book-ipcn65 +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — A Taxonomic revision of Hordeum secalinum, H. capense Bothmer, R. & N. Jacobsen.Bot. Tidsskr.74: 223-230(1979).
CCDB · book-ipcn65 — Bowden 1965b
CCDB · ipcn-api-dl — Love, A. 1980a. In Chromosome number reports LXVII. Taxon 29: 350–351.
CCDB · ipcn-api-dl — Salomon, B., R. v. Bothmer & N. Jacobsen. 1991. Intergeneric crosses between Hordeum and North American Elymus (Poaceae, Triticeae). Hereditas (Lund) 114: 35–39.
CCDB · ipcn-api-dl — Molnar, S. J. & G. Fedak. 1989. Polymorphism in ribosomal DNA repeat units of 12 Hordeum species. Genome 32: 1124–1127.
CCDB · ipcn-api-dl — Frederiksen, S. 1993. Taxonomic studies in some annual genera of the Triticeae (Poaceae). Nordic J. Bot. 13: 481–493.
CCDB · ipcn-api-dl — Bothmer, R. v. & N. Jacobsen. 1979. A taxonomic revision of Hordeum secalinum and H. capense. Bot. Tidsskr. 74: 223–230.
CCDB · ipcn-api-dl — Vahidy, A. A. & B. Jahan. 1998. Karyological studies in some species of Hordeum L. Pakistan J. Bot. 30(1): 101–115.
CCDB · kew — Bennett MD, Smith JB. 1971. The 4C nuclear DNA content of several Hordeum genotypes. Canadian Journal of Genetics and Cytology 13: 607-611.
CCDB · Cave1956 — Y. & A. Cauderon
CCDB · CromoCat 2015 — Bothmer, R. & Jacobsen, N. (1979). A Taxonomic revision of Hordeum secalinum, H. capense. Bot. Tidsskr. 74: 223-230.
CCDB · CromoCat 2015 — Frederiksen, S. (1993). Taxonomic studies in some annual genera of the Triticeae (Poaceae) Nordic Journal of Botany 13: 481-493
CCDB · CromoCat 2015 — Linde-Laursen, I. R. von Bothmer & Jacobsen, N. (1986). Giemsa C-banded karyotypes of Hordeum secalinum, H. capense and their interspecific hybrids with H. vulgare. Hereditas (Lund) 105: 179-185
CCDB · CromoCat 2015 — Molnar, S. J. & G. Fedak (1989). Polymorphism in ribosomal DNA repeat units of 12 Hordeum species Genome 32: 1124-1127
CCDB · CromoCat 2015 — Salomon, B., R. von Bothmer & N. Jacobsen (1991). Intergeneric crosses between Hordeum and North American Elymus (Poaceae, Triticeae) Hereditas; genetiskt arkiv. 114: 35-39
2n 146×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · iber-fl +2
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Bowden, W.M. Canad. J. Genet. Cytol. 7: 394-399 (1965)
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · Cave1956 — Y. & A. Cauderon
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Labadie, J. P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 636-639.
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
2n 271×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Linde-Laursen, I. R. von Bothmer & Jacobsen, N. (1986). Giemsa C-banded karyotypes of Hordeum secalinum, H. capense and their interspecific hybrids with H. vulgare. Hereditas (Lund) 105: 179-185
2n 421×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Petrova, A., S. Kozuharov & T. Bancev. (1984). Zavisimosti mezdu kariologiccskite osobenosti i razprostranenicto na vidovete ot roda Hordeum s.l. v Balgarija. V: Savrcmcnni teorcticni i priloznni aspckti na rastitclnata ckologija 1: 234-243.
n 143×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
n 282×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bothmer, R. v. & N. C. Subrahmanyam. 1988. Assessment of chromosome associations in haploids and their parental accessions in Hordeum. Genome 30: 204–210.
CCDB · CromoCat 2015 — Bothmer, R. von & Subrahmanyam, N.C. (1988). Assessment of chromosome associations in haploids and their parental accessions in Hordeum. Genome 30:204-210
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type56 629 records
Wild obs. + sensor55 066
Museum / vouchered1 439
Cultivated / captive30
Other94
Origin
Native8 301
Introduced61
Range
Area of Occupancy AOO58 036 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy39% within 1 km
≤100 m 5 553≤1 km 12 458≤10 km 27 968>10 km 126
46 105 georeferenced · 8 961 without coordinates
Open the mapobservation + sensor55 066
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 51≤1 km 229≤10 km 226>10 km 17
523 georeferenced · 916 without coordinates
Open the institutions mapphysical evidence1 439
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy31% within 1 km
≤1 km 4>10 km 9
13 georeferenced · 17 without coordinates
Open the mapnot free-living30
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions49 of 96 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| South Kensington, GB | 219 |
| MeiseBGlocation not on record | 120 |
| LDlocation not on record | 96 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 39 |
| BFLlocation not on record | 37 |
| BIO-UNIPIlocation not on record | 30 |
| BDBClocation not on record | 29 |
| Uppsala, SE | 22 |
| MAlocation not on record | 18 |
| DBF-NHMDlocation not on record | 17 |
| UGentlocation not on record | 16 |
| Museo Entomologico de Leonlocation not on record | 15 |
| Entomological Society of Latvialocation not on record | 14 |
| Oskarshamn, SE | 13 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| BRNUlocation not on record | 11 |
| Dresden, DE | 11 |
| SWE054location not on record | 10 |
| Pamplona, ES | 9 |
| Bern, CH | 8 |
| Sichuan Agricultural Universitylocation not on record | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 8 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 8 |
| València, ES | 8 |
| Moscow State Universitylocation not on record | 7 |
| Salamanca, ES | 7 |
| BClocation not on record | 7 |
| Barcelona, ES | 6 |
| CICYTEXlocation not on record | 6 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Nijmegen, NL | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Badajoz, ES | 5 |
| Görlitz, DE | 5 |
| CJBGlocation not on record | 5 |
| Tilburg, NL | 5 |
| Frankfurt am Main | 4 |
| Brisbane, AU | 4 |
| Pamplona, ES | 4 |
| Mlocation not on record | 4 |
| Berlin, DE | 4 |
| Brussel, BE | 3 |
| Granada, ES | 3 |
| Namur, BE | 3 |
| Córdoba, ES | 3 |
| Bloomington, US | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| Vitoria, ES | 3 |
| National Museum Waleslocation not on record | 3 |
| Wlocation not on record | 3 |
| Bourges, FR | 3 |
| Sevilla, ES | 3 |
| Regensburgische Botanische Gesellschaftlocation not on record | 3 |
| BSBIlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Porrentruy, CH | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Zürich, CH | 2 |
| MCNAMlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| H-Adlerlocation not on record | 2 |
| LfUlocation not on record | 2 |
| Olocation not on record | 2 |
| Adelaide, AU | 2 |
| Trondheim, NO | 2 |
| ER Hellerlocation not on record | 2 |
| Paris, FR | 1 |
| SZUlocation not on record | 1 |
| Bronx, US | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Alicante, ES | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Xiamen, CN | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Dekalb, US | 1 |
| New Brunswick, US | 1 |
| Coimbra, PT | 1 |
| Monastir, TN | 1 |
| Bergen, NO | 1 |
| Madrid, ES | 1 |
| Madrid, ES | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Fribourg, CH | 1 |
| Hazara Universitylocation not on record | 1 |
| Podgorica, ME | 1 |
| Mount Annan, AU | 1 |
| Clemson, US | 1 |
| Durango, US | 1 |
| Palmerston North, NZ | 1 |
| Canberra, AU | 1 |
| Kew, GB | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
96 institutions · 968 of 1 439 vouchered records shown · 466 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Hordeum secalinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 10.1–17.2
Seasonal swing summer↔winter14.0 °C
Max temp (day)20.0 °C 13.1–20.3
Min temp (night)9.00 °C 7.60–13.8
Precipitation72.1 mm/mo 33.4–94.8
Air humidity61.4 % 52.9–64.1
Moisture balance-37.0 mm/mo -61.7–4.10
Vapour deficit756 Pa 481–953
Wind speed3.90 m/s 2.00–4.60
Cloud cover43.5 % 38.3–51.1
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.