Hordeum parodii

Covas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Hordeum

At a glance

Occurrence records144

Data sources12

Biological traits13

DNA specimens10

eDNA detections10

Sources12 archives

Databases and archives Hordeum parodii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF144 records

Environmental DNA1 datasets · 0 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB · GoaT12.8 Gbp

01Narrative

Hordeum parodii is a species of barley native to Argentina, where it can be found in inland wetlands, coastal and supratidal lands. H. parodii is a small annual grass forming petite patches of thin, hairy leaves and erect stems to about 10 cm height. First described by Guillermo Covas, from whom it received its current name.Covas, 1951 In: Revista Argent. Agron. 18: 74 H. patagonicum is included in the same family as grass. No subspecies are listed in the Catalog of Life.Roskov Y., Kunze T., Orrell T., Abucay L., Paglinawan L., Culham A., Bailly N., Kirk P., Bourgoin T., Baillargeon G., Decock W., The Wever A., Didžiulis V. (ed.) (February 15, 2014). "Species 2000 & ITIS Catalog of Life: 2014 Annual Checklist." Species 2000: Reading, UK. Accessed 22 February 2019

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Deciduousnessn.d.

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max800 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum parodii has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes3

GenBank sequences10

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY255049.1 ↗218 bp

ACGT

TCGTGACCCTGACCAAAACAGACCGTGCTCGTGTCATCCAATCCGCCGACGATGGCACCAACCGTCGCTCGGACAAGCCCTCGACCACCT …

Hordeum parodii internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hordeum parodii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size12 806 910 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hordeum parodii12.81 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy6× hexaploid · measured

Chromosome records42–422n range42median42mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 427×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Bothmer, R. v., N. Jacobsen & R. B. Jorgensen. 1986. Taxonomy, variation, and relationships in the Hordeum parodii group (Poaceae). Nordic J. Bot. 6(4): 399–410.

CCDB · ipcn-api-dl — Jessop, C. M. & N. C. Subrahmanyam. 1984. Nucleolar number variation in Hordeum species, their haploids and interspecific hybrids. Genetica 64: 93–100.

CCDB · ipcn-api-dl — Balyan, H. S. & G. Fedak. 1991. A study on genome relationships in Hordeum parodii, Hordeum jubatum, Elymus trachycaulus and Elymus canadensis. Cytologia 56: 431–436.

CCDB · ipcn-api-dl — Subrahmanyam, N. C. 1978. Meiosis in polyhaploid Hordeum: Hemizygous ineffective control of diploid-like behaviour in a hexaploid?. Chromosoma 66: 185–192.

CCDB · book-atlas-flowering-plants — Patagonia

CCDB · kew — Jakob SS, Meister A, Blattner FR. 2004. Considerable genome size variation of Hordeum species (Poaceae) is linked to phylogeny, life form, ecology, and speciation rates. Molecular Biology and Evolution 21: 860-869.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type144 records

Museum / vouchered91

Cultivated / captive23

Other30

Origin

Native29

Range

Area of Occupancy AOO244 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 91 records without

Open the institutions mapphysical evidence91

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 23

23 georeferenced

Open the mapnot free-living23

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stadt Seeland, Ortsteil Gatersleben, DE	24
SWE054location not on record	23
Ciudad Autónoma de Buenos Aires, AR	17
San Isidro, AR	9
Castelar, AR	5
Kew, GB	4
Laboratory of Palaeontologylocation not on record	2
BAlocation not on record	2
Córdoba, AR	2
South Kensington, GB	1
Edinburgh, GB	1

11 institutions · 90 of 91 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Hordeum parodii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)