Hordeum murinum
speciesAt a glance
Occurrence records193 798
Data sources14
Biological traits60
DNA specimens197
eDNA detections189
Sources14 archives
Databases and archives Hordeum murinum's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility193 798 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI189 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics197 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources60 traits
Occurrence & distributionGBIF193 798 records
Environmental DNA1 datasets · 15 countries189 detections
DNA & barcodingBOLD · NCBI197 specimens
Genome at a glanceCCDB · GoaT9.5 Gbp
01Narrative
Hordeum murinum, commonly known as wall barley or false barley, is a species of grass.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology21
Leaf length110 mm
Leaf length max200 mm
Leaf length min70 mm
Leaf mass5.28 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 504 mm² · GIFT: 520 mm²
Leaf width5 mm
⚠ sources differ — AusTraits: 5 mm · GIFT: 4 mm
Leaf width max15 mm
Leaf width min3 mm
Plant height0.353 m
⚠ sources differ — GIFT: 0.353 m · AusTraits: 0.175 m · LEDA: 0.307 m · TRY: 0.27 m
Plant height generative0.42 m
Plant height max0.7 m
Plant height min0.1 m
Seed length6 mm
Seed length max7 mm
Seed length min5 mm
Seed mass8.3 mg
⚠ sources differ — TRY: 8.3 mg · LEDA: 6.55 mg · GIFT: 5.2 mg
Seed mass max11.2 mg
Seed mass min0 mg
Seed width1.6 mm
Seed width max1.7 mm
Seed width min1.5 mm
Life cycle & reproduction15
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flowering endApr
Flowering startJun
Life formannual or biennial
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number23.5
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: H
Habitat GIFTCampo Limpo
Leaf shapefalcate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio12.3 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)216 mg/g
⚠ sources differ — TRY: 216 mg/g · LEDA: 202 mg/g
Leaf n36.36 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)19.13 mm²/mg
⚠ sources differ — TRY: 19.13 mm²/mg · LEDA: 33.7 mm²/mg · GIFT: 34.87 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Inflorescencespike
Seeds per fruit101-1000
05DNA & barcoding197 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum murinum has left across the world's sequence archives.
At a glance
DNA specimens197
Marker genes11
GenBank sequences10
eDNA detections189
Countries17
The DNA barcodea real sequence read deposited for this species
AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACAGACCGTGCTCGTGTCATCCAATCC …
Hordeum murinum voucher Na-104 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★trnL-F★ITS10★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hordeum murinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size9 506 160 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hordeum murinum9.51 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× / 4× cytotypes
Chromosome records14–422n range28median28mode114records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2880×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +18
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4637
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · poland — Mizianty M. and Frey L. 2007. Cytology. In: M. Mizianty and L. Frey (eds.), Biodiversity of wild Triticeae (Poaceae) in Poland as an expression of tribe microevolution. W. Szafer Institute of Botany, Polish Academy of Sciences, Krakw. pp.47-51.
CCDB · ipcn-api-dl — Love, A. 1980a. In Chromosome number reports LXVII. Taxon 29: 350–351.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Parra, R., B. Valdés, I. Fernández, F. A. Holguín, L. M. Rubio & O. Ruiz. 1999. Números cromosómicos de plantas de Marruecos, III. Lagascalia 21(1): 149–154.
CCDB · ipcn-api-dl — Valdés, B., R. Parra, A. M. Sánchez & M. D. Díaz. 1999. Números cromosómicos de plantas de Marruecos, IV. Lagascalia 21(1): 235–240.
CCDB · ipcn-api-dl — Hatch, S. L. 1980. Chromosome numbers of some grasses from the southwestern United States and Mexico. S. W. Naturalist 25: 278–280.
CCDB · ipcn-api-dl — Avagian, I. G., G. M. Atayeva, A. B. Romanova & P. A. Ghandilian. 1989. To the question on systematic situation of some representatives of the genus Hordeum L. Analysis of C-stained chromosomes of taxons of Murina Nevsky series. Biol. Zurn. Armen. 42: 621–629.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Van Loon, J. C. & H. C. M. Snelders. 1979. In IOPB chromosome number reports LXV. Taxon 28: 632–634.
CCDB · ipcn-api-dl — Mizianty, M. 2006. Variability and structure of natural populations of Hordeum murinum L. based on morphology. Pl. Syst. Evol. 261: 139–150.
CCDB · ipcn-api-dl — Nazarova. 2004. Karyological characterization of Armenian species of the genus Hordeum L. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 57–63, 91–95.
CCDB · ipcn-api-dl — Natarajan, G. 1979. Etude caryosystematique de quelques monocotyledones de la garrigue Languedocienne. Nat. Monspel., Sér. Bot. 30: 1–27.
CCDB · ipcn-api-dl — Natarajan, G. 1979a. In IOPB chromosoJne number reports LXV. Taxon 28: 629.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Linde-Laursen, I., R. v. Bothmer & N. Jacobsen. 1989. Giemsa C-banded karyotypes of Hordeum marinum and H. murinum. Genome 32: 629–639.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Jacobsen, N. & R. v. Bothmer. 1995. Taxonomy in the Hordeum murinum complex (Poaceae). Nordic J. Bot. 15(5): 449–458.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — KLIPHUIS, E. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIV. Taxon 28:398–400.
CCDB · ipcn-api-dl — Scholz, H., C. Oberprieler & R. Vogt. 1998. Chromosome numbers of North African Phanerogams. VII. Some notes on North African Gramineae. Lagascalia 20(2): 265–275.
CCDB · ipcn-api-dl — Vahidy, A. A. & B. Jahan. 1998. Karyological studies in some species of Hordeum L. Pakistan J. Bot. 30(1): 101–115.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-northern-plants — Castro & Fontes 1946, L. & L. 1944 b.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dj spermatophyta de Portugal. I. Gramineae, Supl. I. Bol. Soc. Brot. I 4 7 ( Ser . 2 ) : 7 7- 1 0 3 .
CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.
CCDB · book-indian_vol2 — Perak, J.T. 1943 ; Covas, G. 1952 ; Morrison, J.W. 1959; Rajhathy, T. & Morrison, J.W. 1962; Thomas, P.T. 1962; Waisel, Y. 1962; Dahlgren, R. et al. 1971
+35 more references
2n 1429×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · iber-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · ipcn-api-dl — Love, A. 1980a. In Chromosome number reports LXVII. Taxon 29: 350–351.
CCDB · ipcn-api-dl — Farugi, S. A. 1985. Studies of Libyan grasses IX. Breeding system in Hordeum glaucum Steud. Pakistan J. Bot. 17: 305–307.
CCDB · ipcn-api-dl — Avagian, I. G., G. M. Atayeva, A. B. Romanova & P. A. Ghandilian. 1989. To the question on systematic situation of some representatives of the genus Hordeum L. Analysis of C-stained chromosomes of taxons of Murina Nevsky series. Biol. Zurn. Armen. 42: 621–629.
CCDB · ipcn-api-dl — Díaz Lifante, Z., T. Luque & C. S. Bárbara. 1992. Chromosome numbers of plants collected during Iter Mediterraneum II in Israel. Bocconea 3: 229–250.
CCDB · ipcn-api-dl — Nazarova. 2004. Karyological characterization of Armenian species of the genus Hordeum L. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 57–63, 91–95.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Linde-Laursen, I., R. v. Bothmer & N. Jacobsen. 1989. Giemsa C-banded karyotypes of Hordeum marinum and H. murinum. Genome 32: 629–639.
CCDB · ipcn-api-dl — Jacobsen, N. & R. v. Bothmer. 1995. Taxonomy in the Hordeum murinum complex (Poaceae). Nordic J. Bot. 15(5): 449–458.
CCDB · ipcn-api-dl — Scholz, H., C. Oberprieler & R. Vogt. 1998. Chromosome numbers of North African Phanerogams. VII. Some notes on North African Gramineae. Lagascalia 20(2): 265–275.
CCDB · book-northern-plants — Perak 1942.
CCDB · book-indian_vol2 — Morrison, J.W. 1959 ; Bowden, W.M. 1962, 1965a; Rajhathy; T. & Morrison, J.W. 1962; Thomas, P.T. 1962 ; Gould, F .W. 1970 ; Humphries, C.J. et al. 1978
CCDB · book-indian_vol2 — Covas, G. 1949a, 1952 ; Morrison, J.W. 1959
CCDB · book-indian_vol2 — Trofimovskaja, .A.J. & Kobyljansky, W.D. (Fedorov)
CCDB · book-indian_vol2 — Tanji, S. 1925 ; Ghimpu, V. 1931 ; Perak,. J.T. 1943 ; Hubbard, C.E. 1954 ; Waisel, Y. 1962
CCDB · book-atlas-flowering-plants — Covas 1949a
CCDB · kew — Bennett MD, Smith JB. 1971. The 4C nuclear DNA content of several Hordeum genotypes. Canadian Journal of Genetics and Cytology 13: 607-611.
CCDB · Cave1962 — Bowden 1962; Rajhathy
CCDB · Cave1963 — Thomas 1962
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Jacobsen, N. & Von Bothmer, R. (1995). Taxonomy in the Hordeum murinum complex (Poaceae). Nordic J. Bot. 15(5):449-458.
CCDB · CromoCat 2015 — Linde-Laursen, I. R. von Bothmer & Jacobsen, N. (1989). Giemsa C-banded karyotypes of Hordeum marinum and H. murinum Genome 32: 629-639
CCDB · CromoCat 2015 — Scholz, H., C. Oberprieler & R. Vogt (1998). Chromosome numbers of North African Phanerogams. VII. Some notes on North African Gramineae Lagascalia 20(2): 265-275
CCDB · CromoCat 2015 — Probatova, N.S., Seledets, V.P., Rudyka, E.G., Gnutikov, A.A., Kozhevnikova, Z.V. & Barkalov V.Y. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1284-1288
CCDB · iapt — IAPT/IOPB Chromosome Data 25
2n 425×CCDB · ipcn-api-dl · CCDB · kew · CCDB · Cave1962
CCDB · ipcn-api-dl — Avagian, I. G., G. M. Atayeva, A. B. Romanova & P. A. Ghandilian. 1989. To the question on systematic situation of some representatives of the genus Hordeum L. Analysis of C-stained chromosomes of taxons of Murina Nevsky series. Biol. Zurn. Armen. 42: 621–629.
CCDB · ipcn-api-dl — Nazarova. 2004. Karyological characterization of Armenian species of the genus Hordeum L. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 57–63, 91–95.
CCDB · kew — Bennett MD, Smith JB. 1971. The 4C nuclear DNA content of several Hordeum genotypes. Canadian Journal of Genetics and Cytology 13: 607-611.
CCDB · kew — Jakob SS, Meister A, Blattner FR. 2004. Considerable genome size variation of Hordeum species (Poaceae) is linked to phylogeny, life form, ecology, and speciation rates. Molecular Biology and Evolution 21: 860-869.
CCDB · Cave1962 — Bowden 1962
n 79×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cave1962 +2
CCDB · ipcn-api-dl — Ferchichi, A., M. A. Nabli & J. Delay. 1994. Prospection caryologique de la famille des Poaceae en Tunisie steppique. Acta Bot. Gallica 141(3): 327–341.
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · ipcn-api-dl — Faruqi, S. A., H. B. Quraish & M. Inamuddin. 1987. Studies in Libyan grasses X. Chromosome number and some interesting features. Ann. Bot. (Rome) 45: 75–102.
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · Cave1962 — Waisel 1962
CCDB · CromoCat 2015 — Spies, J. J., T. H. Burger & S. M. C. van Wyk (1999). Chromosome studies on African plants. 12. The tribes of subfamily Pooideae Bothalia 29(2): 335-341
CCDB · iapt — IAPT/IOPB Chromosome Data 25
CCDB · iapt — IAPT/IOPB Chromosome Data 28
n 147×CCDB · ipcn-api-dl · CCDB · Cave1958 · CCDB · Cave1962 +1
CCDB · ipcn-api-dl — Faruqi, S. A., H. B. Quraish & M. Inamuddin. 1987. Studies in Libyan grasses X. Chromosome number and some interesting features. Ann. Bot. (Rome) 45: 75–102.
CCDB · ipcn-api-dl — Spies, J. J., T. H. Burger & S. M. C. v. Wyk. 1999. Chromosome studies on African plants. 12. The tribes of subfamily Pooideae. Bothalia 29(2): 335–341.
CCDB · Cave1958 — Morrison 1958
CCDB · Cave1962 — Waisel 1962
CCDB · CromoCat 2015 — Faruqi, S. A., Quraish, H. B. & Inamuddin, M. (1987). Studies in Libyan grasses X. Chromosome number and some interesting features Annali di Botanica 45: 75-102
CCDB · CromoCat 2015 — Spies, J. J., T. H. Burger & S. M. C. van Wyk (1999). Chromosome studies on African plants. 12. The tribes of subfamily Pooideae Bothalia 29(2): 335-341
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~8.43 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin8.43 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type193 798 records
Wild obs. + sensor188 247
Museum / vouchered4 336
Cultivated / captive90
Other1 125
Origin
Native4 651
Introduced10 032
Range
Area of Occupancy AOO235 636 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy38% within 1 km
≤100 m 25 564≤1 km 37 876≤10 km 102 413>10 km 1 507
167 360 georeferenced · 20 887 without coordinates
Open the mapobservation + sensor188 247
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy43% within 1 km
≤100 m 195≤1 km 592≤10 km 956>10 km 90
1 833 georeferenced · 2 503 without coordinates
Open the institutions mapphysical evidence4 336
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy6% within 1 km
≤1 km 1≤10 km 5>10 km 10
16 georeferenced · 74 without coordinates
Open the mapnot free-living90
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions152 of 263 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 306 |
| Berlin, DE | 259 |
| LDlocation not on record | 207 |
| South Kensington, GB | 190 |
| Riverside, US | 141 |
| Uppsala, SE | 127 |
| ASUlocation not on record | 126 |
| MeiseBGlocation not on record | 116 |
| Uniwersytet Warszawskilocation not on record | 97 |
| Santa Barbara, US | 90 |
| QAUlocation not on record | 80 |
| San Luis Obispo, US | 61 |
| Odawara, JP | 57 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 55 |
| Oskarshamn, SE | 52 |
| Denver, US | 52 |
| BIO-UNIPIlocation not on record | 49 |
| Claremont, US | 47 |
| Görlitz, DE | 42 |
| WTUlocation not on record | 42 |
| EL PASO, US | 42 |
| Barcelona, ES | 40 |
| València, ES | 40 |
| Provincia di Livornolocation not on record | 39 |
| Sanda, JP | 38 |
| Helsinki, FI | 35 |
| Logan, US | 33 |
| Moscow State Universitylocation not on record | 33 |
| Adam Mickiewicz University in Poznańlocation not on record | 33 |
| Davis, US | 27 |
| Olocation not on record | 27 |
| Hobart, AU | 27 |
| Dresden, DE | 27 |
| Salzburg, AT | 25 |
| SLU Artdatabankenlocation not on record | 25 |
| Wlocation not on record | 25 |
| BDBClocation not on record | 23 |
| Victoria, CA | 23 |
| ESP004location not on record | 23 |
| MAlocation not on record | 22 |
| Chiba, JP | 22 |
| Shinshu Universitylocation not on record | 20 |
| Turlock, US | 19 |
| BFLlocation not on record | 19 |
| CICYTEXlocation not on record | 19 |
| Wellington, NZ | 18 |
| Moscow, US | 18 |
| BClocation not on record | 17 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 16 |
| Saint Louis, US | 16 |
| Bloomington, US | 16 |
| Vancouver, CA | 15 |
| Zürich, CH | 15 |
| Phoenix, US | 15 |
| UGentlocation not on record | 15 |
| Provo, US | 14 |
| Kawasaki Shi Tama Ku, JP | 14 |
| Zürich, CH | 13 |
| GJOlocation not on record | 13 |
| Uniwersytet Jagiellońskilocation not on record | 13 |
| University of Stellenboschlocation not on record | 13 |
| Frankfurt am Main | 13 |
| Entomological Society of Latvialocation not on record | 13 |
| Tsukuba, JP | 12 |
| Flagstaff, US | 12 |
| Irvine, US | 12 |
| Paris, FR | 11 |
| DBF-NHMDlocation not on record | 11 |
| Trondheim, NO | 11 |
| Edinburgh, GB | 11 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 11 |
| Karlsruhe, DE | 11 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 10 |
| Toyama, JP | 9 |
| BRNUlocation not on record | 9 |
| Córdoba, ES | 9 |
| Yerevan, AM | 9 |
| Ciudad Juárez, MX | 8 |
| Salamanca, ES | 8 |
| GZUlocation not on record | 8 |
| ARM059location not on record | 7 |
| Madrid, ES | 7 |
| TUR-Alocation not on record | 7 |
| Porrentruy, CH | 7 |
| UIBlocation not on record | 7 |
| Frauenfeld, CH | 7 |
| Austin, US | 7 |
| GMBAlocation not on record | 7 |
| National Institute of Biological Resourceslocation not on record | 6 |
| Boise, US | 6 |
| UChlocation not on record | 6 |
| Sagamihara, JP | 6 |
| US | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| Jyväskylä, FI | 6 |
| Vitoria, ES | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Pullman, US | 6 |
| Adelaide, AU | 6 |
| Tilburg, NL | 6 |
| Bando, JP | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Orem, US | 6 |
| Uniwersytet Opolskilocation not on record | 6 |
| Canberra, AU | 6 |
| PRClocation not on record | 6 |
| Chongqing Museumlocation not on record | 6 |
| Bronx, US | 5 |
| Turku, FI | 5 |
| Kew, GB | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| National Museum Waleslocation not on record | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Fort Worth, US | 5 |
| Córdoba, AR | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| CASlocation not on record | 4 |
| Brisbane, AU | 4 |
| Tacoma, US | 4 |
| Stockholm, SE | 4 |
| Hiratsuka City Museumlocation not on record | 4 |
| KMNlocation not on record | 4 |
| Corvallis, US | 4 |
| Bourges, FR | 4 |
| SZUlocation not on record | 4 |
| Pamplona, ES | 4 |
| Hazara Universitylocation not on record | 4 |
| Tomioka, JP | 4 |
| San Diego, US | 4 |
| Santa Cruz, US | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| Mlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| IFR-DNFlocation not on record | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Cape Town, ZA | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| Bergen, NO | 3 |
| Mount Annan, AU | 3 |
| Osaka, JP | 3 |
| Portland, US | 3 |
| Clemson, US | 3 |
| Los Angeles, US | 3 |
| Universität Tübingenlocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Sevilla, ES | 3 |
| Pocatello, US | 2 |
| Oulu, FI | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| FLADlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Alicante, ES | 2 |
| Banyoles, ES | 2 |
| Valparaíso, CL | 2 |
| Taipei, TW | 2 |
| Mississippi State, US | 2 |
| Cheney, US | 2 |
| Fargo, US | 2 |
| Sant Julià de Lòria, AD | 2 |
| Xiamen, CN | 2 |
| Bend, US | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| BioFokuslocation not on record | 2 |
| USFSlocation not on record | 2 |
| Denton, US | 2 |
| Durham, US | 2 |
| Auckland, NZ | 2 |
| Coimbra, PT | 2 |
| Göteborg, SE | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| OLAlocation not on record | 2 |
| Badajoz, ES | 2 |
| Arizona Western Collegelocation not on record | 2 |
| QVMAGlocation not on record | 2 |
| Durango, MX | 2 |
| Kochi, JP | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Honolulu, US | 2 |
| Museo Achille Folettolocation not on record | 2 |
| IPE-CSIClocation not on record | 1 |
| Dekalb, US | 1 |
| Weber State Universitylocation not on record | 1 |
| Tartu, EE | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| SWE054location not on record | 1 |
| San Jose, US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Chicago, US | 1 |
| Firenze, IT | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Gijón, ES | 1 |
| Columbia, US | 1 |
| Stephenville, US | 1 |
| Ensenada, MX | 1 |
| Tampa, US | 1 |
| Parkville, AU | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Fribourg, CH | 1 |
| Joondalup, AU | 1 |
| IPA/SPlocation not on record | 1 |
| UniKSlocation not on record | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Mexico City, MX | 1 |
| KOMlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Oswego, US | 1 |
| Nishihara, JP | 1 |
| Fukushima Universitylocation not on record | 1 |
| HUN003location not on record | 1 |
| San Bernardino, US | 1 |
| Arcata, US | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Whitehorse, CA | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| JP | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Sion, CH | 1 |
| PrivatHerblocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Minia, EG | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| JBSlocation not on record | 1 |
| Corrientes, AR | 1 |
| Nishihara, JP | 1 |
| La Paz, BO | 1 |
| Namur, BE | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Valparaiso, CL | 1 |
| Glarus, CH | 1 |
| RJBJCIlocation not on record | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 1 |
| Bangkok, TH | 1 |
| Cascavel, BR | 1 |
| Monastir, TN | 1 |
| GBR016location not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Granada, ES | 1 |
| Armidale, AU | 1 |
| Smithfield, AU | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Grand Junction, US | 1 |
| Macomb, US | 1 |
| Taipei, TW | 1 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 1 |
| Madison, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| SIHUlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Palmerston North, NZ | 1 |
| Winterthur, CH | 1 |
| San Isidro, AR | 1 |
| Tula State Universitylocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
263 institutions · 3 820 of 4 336 vouchered records shown · 320 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA189 detections
Where the DNA of Hordeum murinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found189
Studies independent surveys1
Countries15
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 189 detections have coordinates
Open the map15 countries0
lawnPine-Oak woodland, Soil: Crouch coarse sandy…Oak Woodland/Chaparral with Quercus agrifoli…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 4.20–20.4
Seasonal swing summer↔winter16.9 °C
Max temp (day)18.7 °C 9.40–25.5
Min temp (night)9.80 °C -3.50–14.9
Precipitation48.7 mm/mo 14.6–73.4
Air humidity57.2 % 51.4–62.9
Moisture balance-51.6 mm/mo -130–-25.3
Vapour deficit758 Pa 349–1,202
Wind speed3.50 m/s 2.30–4.50
Cloud cover37.6 % 25.5–45.0
CHELSA 1981–2010, ~9 km grid, at location & month of 50 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.