Hordeum marinum
Huds. · speciesAt a glance
Occurrence records13 573
Data sources13
Biological traits60
DNA specimens72
eDNA detections85
Sources13 archives
Databases and archives Hordeum marinum's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 573 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI85 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics72 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources60 traits
Occurrence & distributionGBIF13 573 records
Environmental DNA1 datasets · 9 countries85 detections
DNA & barcodingBOLD · NCBI72 specimens
Genome at a glanceCCDB · GoaT · NCBI5.4 Gbp
01Narrative
Hordeum marinum, commonly known as sea barley or seaside barley, is a species of grass.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Inflorescence length max5 cm
Inflorescence length min2 cm
Leaf length60 mm
Leaf length max80 mm
Leaf length min40 mm
Leaf mass0.67 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 31.5 mm² · GIFT: 31.5 mm²
Leaf width1.88 mm
⚠ sources differ — AusTraits: 1.88 mm · GIFT: 2 mm
Leaf width max4 mm
Leaf width min1 mm
Plant height0.189 m
⚠ sources differ — GIFT: 0.189 m · AusTraits: 0.25 m · LEDA: 0.128 m · TRY: 0.15 m
Plant height generative0.16 m
Plant height max0.85 m
Plant height min0.1 m
Seed length4 mm
Seed length max4 mm
Seed length min4 mm
Seed mass5.27 mg
⚠ sources differ — TRY: 5.27 mg · GIFT: 1.54 mg
Seed mass max0.875 mg
Seed mass min0.875 mg
Seed width1.2 mm
Seed width max1.2 mm
Seed width min1.2 mm
Life cycle & reproduction16
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flowering endJun
Flowering startMay
Flowering timennnnnnnnyyyn
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number478
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Habitat GIFTCoastal
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio18.24 g/g
Leaf c354 mg/g
Leaf dry-matter content (LDMC)236 mg/g
⚠ sources differ — TRY: 236 mg/g · LEDA: 221 mg/g
Leaf n19.4 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)30.51 mm²/mg
⚠ sources differ — TRY: 30.51 mm²/mg · LEDA: 48.97 mm²/mg · GIFT: 48.97 mm²/mg
Other traits3
Diaspore typefruit
Inflorescencespike
Seeds per fruit101-1000
05DNA & barcoding72 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum marinum has left across the world's sequence archives.
At a glance
DNA specimens72
Marker genes6
GenBank sequences10
eDNA detections85
Countries11
The DNA barcodea real sequence read deposited for this species
TCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCAAAACACGCTCTCAATCACCCTCTTC …
Hordeum marinum subsp. gussoneanum isolate 10GE 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL1★rbcLa★trnL-F★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Hordeum marinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 379 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hordeum marinum5.38 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–702n range14median14mode81records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1460×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Murín A. & Svobodová Z., 1992: Karyological study of the Slovak flora XXVI. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 59-62.
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4643
CCDB · ipcn-api-dl — Finch, R. A. 1983. Tissue-specific elimination of alternative whole parental genomes in one barley hybrid. Chromosoma 88: 386–393.
CCDB · ipcn-api-dl — Gandilian, P. A. & I. G. Avagian. 1988. To the study of genofund of wild barley species in Armenia. Biol. Zurn. Armen. 41: 473–477.
CCDB · ipcn-api-dl — Heslop-Harrison, J. S., J. B. Smith & M. D. Bennett. 1988. The absence of the somatic association of centromeres of homologous chromosomes in grass mitotic metaphases. Chromosoma 96: 119–131.
CCDB · ipcn-api-dl — Salomon, B., R. v. Bothmer & N. Jacobsen. 1991. Intergeneric crosses between Hordeum and North American Elymus (Poaceae, Triticeae). Hereditas (Lund) 114: 35–39.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Vahidy, A. A. & B. Jahan. 1998. Karyological studies in some species of Hordeum L. Pakistan J. Bot. 30(1): 101–115.
CCDB · ipcn-api-dl — Nazarova. 2004. Karyological characterization of Armenian species of the genus Hordeum L. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 57–63, 91–95.
CCDB · ipcn-api-dl — Love, A. 1980a. In Chromosome number reports LXVII. Taxon 29: 350–351.
CCDB · ipcn-api-dl — Murín, A. & Z. Svobodová. 1992. Karyological study of the Slovak flora XXVI. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 39: 59–65.
CCDB · ipcn-api-dl — Lushnikova, A. A. 1988. Chromosome analysis of Hordeum marinum Huds. (2x, 4x). Genetika 24: 1897–1900.
CCDB · ipcn-api-dl — Bothmer, R. v., J. Flink, N. Jacobsen & R. B. Jo|1rgensen. 1989. Variation and differentiation in Hordeum marinum (Poaceae). Nordic J. Bot. 9: 1–10.
CCDB · ipcn-api-dl — Linde-Laursen, I., R. v. Bothmer & N. Jacobsen. 1989. Giemsa C-banded karyotypes of Hordeum marinum and H. murinum. Genome 32: 629–639.
CCDB · ipcn-api-dl — Ørgaard, M. 1994. Intergeneric hybridization between species of Leymus, Psathyrostachys and Hordeum (Poaceae, Triticeae). Ann. Bot. (London) 73: 471–479.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-atlas-flowering-plants — Covas 1949a
CCDB · book-atlas-flowering-plants — Wulff 1937a
CCDB · kew — Bennett MD, Smith JB. 1971. The 4C nuclear DNA content of several Hordeum genotypes. Canadian Journal of Genetics and Cytology 13: 607-611.
CCDB · Cave1962 — Rajhathy & Morr. 1962; Bowden 1962
CCDB · Cave1963 — Thomas 1962
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Kliphuis, E. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 267-268.
CCDB · CromoCat 2015 — Nazarova, E. A. (2004). Karyological characterization of Armenian species of the genus Hordeum L. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 57–63, 91–95.
CCDB · CromoCat 2015 — Bothmer, R. von, Flink, J., Jacobsen, N. & Jorgensen, R. B. (1989). Variation and differentiation in Hordeum marinum (Poaceae) Nordic Journal of Botany 9: 1-10
CCDB · CromoCat 2015 — Linde-Laursen, I. R. von Bothmer & Jacobsen, N. (1989). Giemsa C-banded karyotypes of Hordeum marinum and H. murinum Genome 32: 629-639
CCDB · CromoCat 2015 — Lushnikova, A. A. (1988). Chromosome analysis of Hordeum marinum Huds. (2x, 4x) Genetika 24: 1897-1900
CCDB · CromoCat 2015 — Orgaard, M. (1994). Intergenetic hybridization between species of Leymus, Psathyrostachys and Hordeum (Poaceae, Triticeae). Ann. Bot. (Oxford) 73:471-479
CCDB · CromoCat 2015 — Cauderon, Y. & Cauderon, A. (1956). Étude de l'hybride F1 entre Hordeum bulbosum L. et H. secalinum Schreb Ann. Inst. Natl. Rech. Agron., Ser. B. 6: 307-317.
CCDB · CromoCat 2015 — Covas, G. (1949). Taxonomic observations on the North American species of Hordeum. Madroño 9: 1-21.
CCDB · CromoCat 2015 — Covas, G. (1952). Número de cromosómas de las especies de Hordeum. Revista Argent. Agron. 19: 52-53.
CCDB · CromoCat 2015 — Dempsey, R. E., Gornall, R. J. & Bailey, J. P. (1994). Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63-66.
CCDB · CromoCat 2015 — Finch, R. A. (1983). Tissue-specific elimination of alternative whole parental genomes in one barley hybrid. Chromosoma 88: 386-393
+15 more references
2n 2819×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants +2
CCDB · iber-fl — Primeiro contacto citolgico com a flora halfila dos salgados de Sacavm. Castro, D. & F. Carvalho Fontes.Brotria Ci. Nat.15(1): 38-46(1946).
CCDB · ipcn-api-dl — Linde-Laursen, I., E. Ibsen, R. v. Bothmer & H. Giese. 1992. Physical localization of active and inactive rRNA gene loci in Hordeum marinum spp. gussoneanum (4x) by in situ hybridization. Genome 35: 1032–1036.
CCDB · ipcn-api-dl — Sokolovskaya, A. P. & N. S. Probatova. 1979. Chromosome numbers of some grasses (Poaceae) in the U.S.S.R. flora. III. Bot. Zhurn. 64 (9): 1245–1258.
CCDB · ipcn-api-dl — Pershina, L. A., V. K. Shumny, L. I. Belova & O. M. Numerova. 1985. Interspecific and bigeneric hybridization of Hordeum geniculatum All. Citol. Genet. (Kiev). 19(6): 428–433.
CCDB · ipcn-api-dl — Gandilian, P. A. & I. G. Avagian. 1988. To the study of genofund of wild barley species in Armenia. Biol. Zurn. Armen. 41: 473–477.
CCDB · ipcn-api-dl — Numerova, O. M. 1989. Structura genoma dikoj yachmennoj travy Hordeum geniculatum All. Pp. 101--102 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Nazarova. 2004. Karyological characterization of Armenian species of the genus Hordeum L. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 57–63, 91–95.
CCDB · book-atlas-flowering-plants — Fo
CCDB · book-atlas-flowering-plants — Castro & F. 1946
CCDB · book-atlas-flowering-plants — Chin 1941
CCDB · kew — Jakob SS, Meister A, Blattner FR. 2004. Considerable genome size variation of Hordeum species (Poaceae) is linked to phylogeny, life form, ecology, and speciation rates. Molecular Biology and Evolution 21: 860-869.
CCDB · CromoCat 2015 — Castro, D. & Carvalho Fontes, F. (1946). Primeiro contacto citológico com a flora halófila dos salgados de Sacavém. Broteria Cienc. Nat. 15(1): 38-46.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & N. S. Probatova. (1979). Chromosome numbers on some grasses (Poaceae) of the URSS flora. III. Bot. Žurn. 64: 1245- 1258.
CCDB · CromoCat 2015 — Bothmer, R. von, Flink, J., Jacobsen, N. & Jorgensen, R. B. (1989). Variation and differentiation in Hordeum marinum (Poaceae) Nordic Journal of Botany 9: 1-10
CCDB · CromoCat 2015 — Linde-Laursen, I. R. von Bothmer & Jacobsen, N. (1989). Giemsa C-banded karyotypes of Hordeum marinum and H. murinum Genome 32: 629-639
CCDB · CromoCat 2015 — Linde-Laursen, I., Ibsen, E., von Bothmer, R. & Giese, H. (1992). Physical localization of active and inactive rRNA gene loci in Hordeum marinum spp. gussoneanum (4x) by in situ hybridization Genome 35: 1032-1036
CCDB · CromoCat 2015 — Lushnikova, A. A. (1980). Chromosome analysis of Hordeum marinum Huds. (2x, 4x) Genetika 24: 1897-1900
CCDB · CromoCat 2015 — Orgaard, M. (1994). Intergenetic hybridization between species of Leymus, Psathyrostachys and Hordeum (Poaceae, Triticeae). Ann. Bot. (Oxford) 73:471-479
2n 702×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Numerova. 2004. Barley chromosome identification using genomic in situ hybridization in the genome of backcrossed progeny of barley-wheat amphiploids [Hordeum geniculatum All. (2n = 28) @x Triticum aestivum L. (2n = 42)] (2n = 70). Genetika 40: 1229–1233.
CCDB · ipcn-api-dl — Pershina. 2004. Expression of fertility during morphogenesis in self-pollinated backcrossed progenies of barley-wheat amphiploids [Hordeum geniculatum All. (2n = 28) @x Triticum aestivum L. (2n =42)] (2n = 70). Genetika 40: 636–641.
n 78×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). I. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 29-66(1990).
CCDB · ipcn-api-dl — Symeonidis, L. & M. Moustakas. 1986. Biosystematic study of Hordeum marinum group in Greece. Flora 178: 177–182.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, R. Tormo, A. Muñoz, M. C. Viera, J. Carrasco, A. Ortega & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., sér. 2 63: 153–205.
CCDB · CromoCat 2015 — Symeonidis, L. & M. Moustakas. (1986). Biosystematic study of Hordeum marinum group in Greece. Flora 178: 177-182
CCDB · CromoCat 2015 — Devesa, J.A., Ruiz, T., Tormo, R., Muñoz, A., Viera, M. C., Carrasco, J., Ortega, A. & Pastor, J. (1990). Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., Sér. 2 63:153-205
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bothmer, R. von & Subrahmanyam, N.C. (1988). Assessment of chromosome associations in haploids and their parental accessions in Hordeum. Genome 30:204-210
n 281×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bothmer, R. von & Subrahmanyam, N.C. (1988). Assessment of chromosome associations in haploids and their parental accessions in Hordeum. Genome 30:204-210
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
07Deep time~6.3 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin6.3 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type13 573 records
Wild obs. + sensor11 636
Museum / vouchered1 648
Cultivated / captive23
Other266
Origin
Native886
Introduced2 570
Range
Area of Occupancy AOO20 852 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 2 718≤1 km 1 937≤10 km 6 074>10 km 69
10 798 georeferenced · 838 without coordinates
Open the mapobservation + sensor11 636
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 154≤1 km 341≤10 km 387>10 km 41
923 georeferenced · 725 without coordinates
Open the institutions mapphysical evidence1 648
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy75% within 1 km
≤1 km 3≤10 km 1
4 georeferenced · 19 without coordinates
Open the mapnot free-living23
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 118 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| South Kensington, GB | 257 |
| Museo Entomologico de Leonlocation not on record | 127 |
| Adelaide, AU | 121 |
| BIO-UNIPIlocation not on record | 101 |
| LDlocation not on record | 83 |
| MeiseBGlocation not on record | 48 |
| València, ES | 47 |
| CICYTEXlocation not on record | 43 |
| Riverside, US | 39 |
| Kensington, AU | 31 |
| US | 30 |
| Brussel, BE | 27 |
| Mount Annan, AU | 26 |
| MAlocation not on record | 25 |
| Canberra, AU | 24 |
| BClocation not on record | 20 |
| Vitoria, ES | 18 |
| BRNUlocation not on record | 17 |
| San Luis Obispo, US | 16 |
| Alicante, ES | 16 |
| Barcelona, ES | 15 |
| Sichuan Agricultural Universitylocation not on record | 14 |
| Entomological Society of Latvialocation not on record | 13 |
| Pamplona, ES | 13 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Berlin, DE | 12 |
| Salamanca, ES | 12 |
| Hobart, AU | 11 |
| Córdoba, ES | 11 |
| Brisbane, AU | 11 |
| ESP004location not on record | 11 |
| Madrid, ES | 10 |
| Wlocation not on record | 10 |
| Bern, CH | 9 |
| BDBClocation not on record | 9 |
| NSW Office of Environment and Heritagelocation not on record | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| UIBlocation not on record | 9 |
| Dresden, DE | 9 |
| Granada, ES | 9 |
| Jaén, ES | 8 |
| Santa Barbara, US | 8 |
| Moscow, US | 7 |
| Claremont, US | 7 |
| Pamplona, ES | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Provo, US | 5 |
| Wellington, NZ | 5 |
| Philadelphia, US | 5 |
| Uppsala, SE | 5 |
| Christchurch, NZ | 4 |
| Davis, US | 4 |
| ASUlocation not on record | 4 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 4 |
| WTUlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| Santa Cruz, US | 3 |
| Tacoma, US | 3 |
| BSBIlocation not on record | 3 |
| Bourges, FR | 3 |
| Armidale, AU | 3 |
| Denver, US | 2 |
| Paris, FR | 2 |
| Kew, GB | 2 |
| Oskarshamn, SE | 2 |
| Xiamen, CN | 2 |
| Saint Louis, US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Badajoz, ES | 2 |
| Auckland, NZ | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Bronx, US | 2 |
| Logan, US | 2 |
| ISAlocation not on record | 2 |
| International Salmonella Centre (W.H.O.)location not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| San Diego, US | 2 |
| Pretoria, ZA | 2 |
| Weber State Universitylocation not on record | 2 |
| Victoria, CA | 1 |
| La Trobe Universitylocation not on record | 1 |
| ESP003location not on record | 1 |
| Henderson, US | 1 |
| San Angelo, US | 1 |
| US | 1 |
| University of Stellenboschlocation not on record | 1 |
| CASlocation not on record | 1 |
| Turlock, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Zürich, CH | 1 |
| Helsinki, FI | 1 |
| HUN003location not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Durango, US | 1 |
| BGPAlocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| Garðabær, IS | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Beijing, CN | 1 |
| Frankfurt am Main | 1 |
| Orem, US | 1 |
| Irvine, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Phoenix, US | 1 |
| Görlitz, DE | 1 |
| Göteborg, SE | 1 |
| Yerevan, AM | 1 |
| Rishon Le Zion, IL | 1 |
| JBSlocation not on record | 1 |
| Flagstaff, US | 1 |
| CJBGlocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| EL PASO, US | 1 |
| Ashland, US | 1 |
| IDElocation not on record | 1 |
118 institutions · 1 517 of 1 648 vouchered records shown · 127 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA85 detections
Where the DNA of Hordeum marinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found85
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 85 detections have coordinates
Open the map9 countries0
Phenology=FFL
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 11.2–22.0
Seasonal swing summer↔winter21.1 °C
Max temp (day)20.1 °C 15.4–27.6
Min temp (night)10.4 °C 6.40–14.9
Precipitation48.7 mm/mo 5.50–64.4
Air humidity55.2 % 39.8–62.8
Moisture balance-51.6 mm/mo -124–-20.5
Vapour deficit804 Pa 613–1,940
Wind speed2.40 m/s 2.00–3.10
Cloud cover38.3 % 21.6–45.3
CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.