Hordeum jubatum
speciesAt a glance
Occurrence records28 696
Data sources13
Biological traits51
DNA specimens83
eDNA detections47
Sources13 archives
Databases and archives Hordeum jubatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility28 696 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics83 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources51 traits
Occurrence & distributionGBIF28 696 records
Environmental DNA1 datasets · 5 countries47 detections
DNA & barcodingBOLD · NCBI83 specimens
Genome at a glanceCCDB · GoaT8.6 Gbp
01Narrative
Hordeum jubatum, communément appelée orge à crinière ou orge barbue ou orge queue-d'écureuil est une plante herbacée de la famille des Poaceae. En latin, jubatus signifie avec une crinière.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVP
Size & morphology19
Leaf length max120 mm
Leaf mass6.67 mg
Leaf size181 mm²
Leaf width2 mm
Leaf width max2 mm
Leaf width min2 mm
Plant height0.5 m
Plant height generative0.4 m
Plant height max0.75 m
Plant height min0.15 m
Seed length3.2 mm
Seed length max3.2 mm
Seed length min3.2 mm
Seed mass1.24 mg
⚠ sources differ — TRY: 1.24 mg · LEDA: 0.871 mg · GIFT: 1.49 mg
Seed mass max4.98 mg
Seed mass min1.12 mg
Seed width1.2 mm
Seed width max1.2 mm
Seed width min1.2 mm
Life cycle & reproduction12
Deciduousnessdeciduous
Dispersal typeanimal
Flowering endAug
Flowering startJun
Life formbiennial or perennial
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number28 612
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Graminoid
Habitat GIFTLowland
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio16.57 g/g
Leaf c373 mg/g
Leaf dry-matter content (LDMC)246 mg/g
Leaf n21.89 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)21.5 mm²/mg
⚠ sources differ — TRY: 21.5 mm²/mg · LEDA: 23.66 mm²/mg · GIFT: 23.67 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding83 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum jubatum has left across the world's sequence archives.
At a glance
DNA specimens83
Marker genes11
GenBank sequences10
eDNA detections47
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCAA …
Hordeum jubatum voucher MONT:87310 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★trnL-F★ITS4★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hordeum jubatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size8 572 169 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hordeum jubatum8.57 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–282n range28median28mode35records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2833×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · nw-europe-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iapt
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4640
CCDB · book-ipcn65 — Mitchell & H. 1965
CCDB · ipcn-api-dl — Pershina, L. A., V. K. Shumny, L. I. Belova & O. M. Numerova. 1985. Interspecific and bigeneric hybridization of Hordeum geniculatum All. Citol. Genet. (Kiev). 19(6): 428–433.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1982. Synopsis of chromosome numbers in Poaceae from the Soviet Far East. I. The tribes Oryzeae, Brachypodieae, Triticeae. Bot. Zhurn. SSSR 67 (1): 62–70.
CCDB · ipcn-api-dl — Rudyka, E. G. 1986. Chromosome numbers in some representatives of the Alliaceae, Fabaceae, Malvaceae, Poaceae families. Bot. Zhurn. 71: 1426–1427.
CCDB · ipcn-api-dl — Yang, J. l., C. Yen, B. Lu & R. v. Bothmer. 1987. The genus Hordeum (Gramineae) in China. Variation and distribution. Willdenowia 16: 479–490.
CCDB · ipcn-api-dl — Salomon, B., R. v. Bothmer & N. Jacobsen. 1991. Intergeneric crosses between Hordeum and North American Elymus (Poaceae, Triticeae). Hereditas (Lund) 114: 35–39.
CCDB · ipcn-api-dl — Bothmer, R. v. & N. Jacobsen. 1989. Interspecific hybridization with Hordeum guatemalense. Genetica 79: 147–151.
CCDB · ipcn-api-dl — Balyan, H. S. & G. Fedak. 1991. A study on genome relationships in Hordeum parodii, Hordeum jubatum, Elymus trachycaulus and Elymus canadensis. Cytologia 56: 431–436.
CCDB · ipcn-api-dl — Seberg, O. & I. Linde-Laursen. 1996. Eremium, a new genus of the Triticeae (Poaceae) from Argentina. Syst. Bot. 21(2): 3–15.
CCDB · ipcn-api-dl — Murray, L. E. & W. Tai. 1980. Genome relations of Agropyron sericeum, Hordeum jubatum and s their hybrids. Amer. J. Bot. 67: 1374–1379.
CCDB · ipcn-api-dl — Julien, M. 2002. Documentation chromosomíque. Contribution no. 4. Ludoviciana 30: 62–63.
CCDB · ipcn-api-dl — Love, A. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 166–169.
CCDB · ipcn-api-dl — Baden, C. & R. v. Bothmer. 1994. A taxonomic revision of Hordeum sect. Critesion. Nordic J. Bot. 14(2): 117–136.
CCDB · book-ipcn66 — Rajhathy & Symko 1966
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-ipcn67-71 — MITCHELL, W.W., & H.J. HODGSON. 1968. Hybridization within the Triticeae of Alaska: A new X Elyhordeum and comments. Rhodora 70: 467-473.
CCDB · book-ipcn67-71 — HEDBERG, o. 1967. Chromosome numbers of vascular plants from arctic and subarctic North America. Ark. f. Bot. Ser. 2. 6: 309-326.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Chromosome numbers in some species of plants of the north-eastern part of the USSR. II. (In Russian). Bot. Zhur. 52: 983-987.
CCDB · eflora
CCDB · book-atlas-flowering-plants — Aase & P. 1926
CCDB · Cave1956 — Love & Love b
CCDB · Cave1956supp — Covas 1949
CCDB · Cave1959 — Bowden 1958; Rajh. & Morris. 1959b
CCDB · Cave1962 — Bowden 1962
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · iapt — IAPT/IOPB Chromosome Data 30
2n 142×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants
CCDB · ipcn-api-dl — Vahidy, A. A. & B. Jahan. 1998. Karyological studies in some species of Hordeum L. Pakistan J. Bot. 30(1): 101–115.
CCDB · book-atlas-flowering-plants — Tanzi 1925
n 72×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.
CCDB · ipcn-api-dl — Murray, L. E. & W. Tai. 1980. Genome relations of Agropyron sericeum, Hordeum jubatum and s their hybrids. Amer. J. Bot. 67: 1374–1379.
n 142×CCDB · book-ipcn73-74 · CCDB · Cave1956supp
CCDB · book-ipcn73-74 — SCHOOLER, A.B., A.R. BELL, & J.D. NALEWAJA. 1972. Crosses between Hordeum jubatum L. and Taeniatherum asperum (Sim. l Nevski to determine genomic relationships. Crop Sci. (Madison) 12: 542-544.
CCDB · Cave1956supp — Boyle & Holm. 1955
n 281×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bothmer, R. v. & N. C. Subrahmanyam. 1988. Assessment of chromosome associations in haploids and their parental accessions in Hordeum. Genome 30: 204–210.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type28 696 records
Wild obs. + sensor22 420
Museum / vouchered5 756
Cultivated / captive50
Other470
Origin
Native436
Introduced752
Range
Area of Occupancy AOO66 760 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 11 673≤1 km 2 604≤10 km 2 935>10 km 801
18 013 georeferenced · 4 407 without coordinates
Open the mapobservation + sensor22 420
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 429≤1 km 895≤10 km 1 100>10 km 440
2 864 georeferenced · 2 892 without coordinates
Open the institutions mapphysical evidence5 756
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy64% within 1 km
≤1 km 27≤10 km 12>10 km 3
42 georeferenced · 8 without coordinates
Open the mapnot free-living50
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions182 of 301 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 266 |
| International Salmonella Centre (W.H.O.)location not on record | 207 |
| Moscow State Universitylocation not on record | 165 |
| LDlocation not on record | 160 |
| Olocation not on record | 154 |
| Madison, US | 147 |
| Bronx, US | 143 |
| Wuzhou, CN | 126 |
| Chongqing Museumlocation not on record | 126 |
| Logan, US | 125 |
| Québec, CA | 102 |
| Université Lavallocation not on record | 96 |
| Albuquerque, US | 93 |
| Chadron, US | 89 |
| Denver, US | 85 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 84 |
| Flagstaff, US | 79 |
| South Kensington, GB | 75 |
| University of Alberta Museumslocation not on record | 74 |
| Oulu, FI | 73 |
| Uppsala, SE | 71 |
| SLU Artdatabankenlocation not on record | 71 |
| Moscow, US | 66 |
| Missoula, US | 64 |
| Mexico City, MX | 64 |
| Irkutsk State Universitylocation not on record | 63 |
| University of Stellenboschlocation not on record | 62 |
| WTUlocation not on record | 60 |
| Vancouver, CA | 58 |
| Saint Louis, US | 57 |
| MeiseBGlocation not on record | 55 |
| Trondheim, NO | 55 |
| ASUlocation not on record | 53 |
| Turku, FI | 52 |
| Riverside, US | 48 |
| Bozeman, US | 47 |
| Victoria, CA | 47 |
| Claremont, US | 46 |
| Oskarshamn, SE | 46 |
| Ann Arbor, US | 43 |
| Acadia Universitylocation not on record | 43 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 43 |
| BRNUlocation not on record | 42 |
| Philadelphia, US | 39 |
| Montréal, CA | 35 |
| BFLlocation not on record | 35 |
| San Isidro, AR | 34 |
| DOI/NPS, Greenbelt Parklocation not on record | 34 |
| Davis, US | 32 |
| KMNlocation not on record | 31 |
| New Haven, US | 31 |
| Pocatello, US | 31 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 30 |
| SWE054location not on record | 27 |
| Tampa, US | 26 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 26 |
| University of New Hampshirelocation not on record | 24 |
| Saint John, CA | 23 |
| Tartu, EE | 23 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 23 |
| Lincoln, US | 22 |
| Canadian Department of Agriculturelocation not on record | 22 |
| WINlocation not on record | 22 |
| Anchorage, US | 22 |
| Boise, US | 20 |
| Weber State Universitylocation not on record | 20 |
| Lubbock, US | 19 |
| Austin, US | 18 |
| Salzburg, AT | 18 |
| Bergen, NO | 17 |
| Montecillo, Texcoco, MX | 17 |
| Kew, GB | 17 |
| Phoenix, US | 16 |
| EL PASO, US | 16 |
| Philadelphia, US | 16 |
| Durango, MX | 16 |
| DBF-NHMDlocation not on record | 15 |
| San Diego, US | 15 |
| Dresden, DE | 15 |
| Caldwell, US | 15 |
| Auckland, NZ | 14 |
| Green Bay, US | 13 |
| Görlitz, DE | 13 |
| University of Winnipeglocation not on record | 13 |
| GB | 13 |
| Allentown, US | 13 |
| Angwin, US | 13 |
| Pullman, US | 12 |
| Dekalb, US | 12 |
| Fort Worth, US | 12 |
| Grand Junction, US | 12 |
| Provincia di Livornolocation not on record | 11 |
| US | 11 |
| Brussel, BE | 11 |
| KIRMlocation not on record | 10 |
| St. Paul, US | 10 |
| Provo, US | 10 |
| Bern, CH | 10 |
| Jyväskylä, FI | 10 |
| Spearfish, US | 10 |
| Uniwersytet Jagiellońskilocation not on record | 10 |
| Mississippi State, US | 9 |
| PRClocation not on record | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Durango, US | 9 |
| College Park, US | 9 |
| Toronto, CA | 9 |
| IDElocation not on record | 9 |
| Arcata, US | 9 |
| Cheney, US | 9 |
| TUR-Alocation not on record | 9 |
| Garðabær, IS | 8 |
| Corvallis, US | 8 |
| Fargo, US | 8 |
| Pretoria, ZA | 8 |
| Pittsburg, US | 8 |
| Torreón, MX | 8 |
| Davenport, US | 8 |
| Bandelier National Monumentlocation not on record | 7 |
| Trois-Rivières, CA | 7 |
| Otaru, JP | 7 |
| Yukon Universitylocation not on record | 7 |
| Beijing, CN | 7 |
| Berlin, DE | 7 |
| Staten Island, US | 7 |
| San Angelo, US | 7 |
| CASlocation not on record | 7 |
| USFSlocation not on record | 6 |
| Burlington, US | 6 |
| Kushiro City Museumlocation not on record | 6 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 6 |
| Paris, FR | 6 |
| Chapingo, MX | 6 |
| Zapopan, MX | 6 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| Kuopio, FI | 6 |
| University of Lethbridgelocation not on record | 6 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Ciudad de México, MX | 5 |
| Stockholm, SE | 5 |
| Millersville, US | 5 |
| VALElocation not on record | 5 |
| Eastern Nevada Landscape Coalitionlocation not on record | 5 |
| Waverly, US | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Durham, US | 5 |
| BSBIlocation not on record | 5 |
| Tacoma, US | 5 |
| TLAXlocation not on record | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| GJOlocation not on record | 5 |
| Mlocation not on record | 5 |
| Odawara, JP | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Bangkok, TH | 5 |
| Whitehorse, CA | 5 |
| Minot State Universitylocation not on record | 4 |
| Umeå Universitylocation not on record | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| Whitewater, US | 4 |
| Ashland, US | 4 |
| San Luis Obispo, US | 4 |
| BAYLUlocation not on record | 4 |
| US | 4 |
| Uniwersytet Wrocławskilocation not on record | 4 |
| US | 4 |
| Karlsruhe, DE | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| Zürich, CH | 4 |
| Santa Barbara, US | 4 |
| Tempe, US | 4 |
| Wlocation not on record | 4 |
| Los Angeles, US | 3 |
| Portland, US | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| Ciudad de México, MX | 3 |
| Tula State Universitylocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Córdoba, AR | 3 |
| Mexico City, MX | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Emporia, US | 3 |
| New Brunswick, US | 3 |
| Nagano City, JP | 3 |
| B.A. Bennett Herbariumlocation not on record | 3 |
| Corrientes, AR | 3 |
| Kirksville, US | 3 |
| Mexico City, MX | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Fulda, DE | 2 |
| Zacatecas, MX | 2 |
| Chicago, US | 2 |
| LPMMBHlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Podgorica, ME | 2 |
| Göteborg, SE | 2 |
| Orem, US | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| Ixtacuixtla de Mariano Matamoros, MX | 2 |
| SIHUlocation not on record | 2 |
| TROMlocation not on record | 2 |
| Bureau of Land Managementlocation not on record | 2 |
| Toyama, JP | 2 |
| State University of New York, College at Oneontalocation not on record | 2 |
| Tomioka, JP | 2 |
| SZUlocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Springfield, US | 2 |
| Oswego, US | 2 |
| Honolulu, US | 2 |
| Zürich, CH | 2 |
| Philadelphia, US | 2 |
| CJBGlocation not on record | 2 |
| Tallinn, EE | 2 |
| nbflocation not on record | 2 |
| Sanda, JP | 2 |
| Wellington, NZ | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Centre for Biodiversity Genomicslocation not on record | 2 |
| Porvoo, FI | 2 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Morelia, MX | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Columbia, US | 1 |
| nlocation not on record | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| COLlocation not on record | 1 |
| Turlock, US | 1 |
| H-Diewaldlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| H-AkrKGlocation not on record | 1 |
| València, ES | 1 |
| Universität Göttingenlocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Tsukuba, JP | 1 |
| Ypsilanti, US | 1 |
| Denton, US | 1 |
| MAlocation not on record | 1 |
| Sichuan Agricultural Universitylocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Wuhan, CN | 1 |
| Cape Town, ZA | 1 |
| Xiamen, CN | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Tromso University Museumlocation not on record | 1 |
| Truckee, US | 1 |
| Bourges, FR | 1 |
| INFlocation not on record | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| KNFHClocation not on record | 1 |
| Elikins, US | 1 |
| Taipei, TW | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Northridge, US | 1 |
| Chapel Hill, US | 1 |
| Brookings, US | 1 |
| LINUlocation not on record | 1 |
| Johnson City, US | 1 |
| Christchurch, NZ | 1 |
| University of Wisconsinlocation not on record | 1 |
| Williamsburg, US | 1 |
| Jackson, US | 1 |
| Sagamihara, JP | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Macomb, US | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Irvine, US | 1 |
| IPA/SPlocation not on record | 1 |
| Henderson, US | 1 |
| Clemson, US | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Bloomington, US | 1 |
| Santa Cruz, US | 1 |
| Castelar, AR | 1 |
| Little Rock, US | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Bend, US | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Fairfax, US | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| San José, CR | 1 |
| 1 | |
| JMSlocation not on record | 1 |
| Yangling, CN | 1 |
| Fredericksburg, US | 1 |
| Barcelona, ES | 1 |
| Hermosillo, MX | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| BClocation not on record | 1 |
| Culiacán, MX | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
301 institutions · 5 458 of 5 756 vouchered records shown · 286 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA47 detections
Where the DNA of Hordeum jubatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found47
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 47 detections have coordinates
Open the map5 countries0
Garden weed. Thin gravelly soil in Quercus g…Montane meadow, Soil: James Cyn loamClay flat muddy area. Standing water while c…Aquatic in shallows with Chara, Nuphar, Myri…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.7 °C 5.70–19.6
Seasonal swing summer↔winter26.1 °C
Max temp (day)22.0 °C 9.00–25.6
Min temp (night)9.00 °C 2.30–14.9
Precipitation61.8 mm/mo 34.7–108
Air humidity56.9 % 50.9–65.4
Moisture balance-67.4 mm/mo -96.6–6.10
Vapour deficit884 Pa 384–1,071
Wind speed3.90 m/s 2.20–4.80
Cloud cover38.2 % 25.5–55.5
CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.