Hordeum brachyantherum
Nevski · speciesAt a glance
Occurrence records4 253
Data sources13
Biological traits104
DNA specimens85
eDNA detections32
Sources13 archives
Databases and archives Hordeum brachyantherum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 253 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics85 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources104 traits
Occurrence & distributionGBIF4 253 records
Environmental DNA1 datasets · 2 countries32 detections
DNA & barcodingBOLD · NCBI85 specimens
Genome at a glanceCCDB · GoaT4.7 Gbp
01Narrative
شعير قصير الأسدية هي نوع نباتي يتبع جنس الشعير من الفصيلة النجيلية.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology6
Plant height0.61 m
⚠ sources differ — GIFT: 0.61 m · USDA: 0.61 m · TRY: 0.29 m
Plant height max0.8 m
Plant height min0.2 m
Seed mass3.53 mg
⚠ sources differ — TRY: 3.53 mg · GIFT: 9.33 mg
Seed mass max6.73 mg
Seed mass min1.03 mg
Life cycle & reproduction28
After harvest regrowth rateSlow
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessdeciduous
Flower colouryellow
Flower conspicuousNo
Flowering endJul
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formherb
Growth form USDABunch
Habitat GIFTmeadows: wet
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.0000000145
Root depth min6 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min100 days
Leaf C:N ratio28.6 g/g
Leaf c398 mg/g
Leaf dry-matter content (LDMC)259 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min20 in
Protein potentialLow
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min6 pH
Specific leaf area (SLA)16.69 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound30 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding85 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum brachyantherum has left across the world's sequence archives.
At a glance
DNA specimens85
Marker genes10
GenBank sequences10
eDNA detections32
Countries2
The DNA barcodea real sequence read deposited for this species
CTTAAACAAAACAGACCGTGAATTTGTCACCAATGCCGCTGGACCTCGGTCCGGCTTTGGCCCCCGACCTTCGTCTAGGAGGGGAGGGGC …
Hordeum brachyantherum subsp. californicum voucher BCC2057 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK8★rbcL1★rbcLa★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hordeum brachyantherum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 694 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hordeum brachyantherum4.69 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records14–422n range28median28mode21records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2817×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov +4
CCDB · ipcn-api-dl — Jessop, C. M. & N. C. Subrahmanyam. 1984. Nucleolar number variation in Hordeum species, their haploids and interspecific hybrids. Genetica 64: 93–100.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1982. Synopsis of chromosome numbers in Poaceae from the Soviet Far East. I. The tribes Oryzeae, Brachypodieae, Triticeae. Bot. Zhurn. SSSR 67 (1): 62–70.
CCDB · ipcn-api-dl — Salomon, B., R. v. Bothmer & N. Jacobsen. 1991. Intergeneric crosses between Hordeum and North American Elymus (Poaceae, Triticeae). Hereditas (Lund) 114: 35–39.
CCDB · ipcn-api-dl — Bothmer, R. v. & N. Jacobsen. 1989. Interspecific hybridization with Hordeum guatemalense. Genetica 79: 147–151.
CCDB · ipcn-api-dl — Seberg, O. & I. Linde-Laursen. 1996. Eremium, a new genus of the Triticeae (Poaceae) from Argentina. Syst. Bot. 21(2): 3–15.
CCDB · ipcn-api-dl — Ørgaard, M. & J. S. Heslop-Harrison. 1994. Relationships between species of Leymus, Psathyrostachys and Hordeum (Poaceae, Triticeae) inferred from Southern hybridization of genomic and cloned DNA probes. Pl. Syst. Evol. 189: 217–231.
CCDB · ipcn-api-dl — Ørgaard, M. & J. S. Heslop-Harrison. 1994. Investigations of genome relationships between Leymus, Psathyrostachys and Hordeum inferred by genomic DNA: DNA in situ hybridization. Ann. Bot. (London) 73: 195–203.
CCDB · ipcn-api-dl — GERVAIS, C., R. Trahan & J. Gagnon. 1999. IOPB chromosome data 14. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 30: 10–15.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Love, A. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 166–169.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-fedorov — Covas 1952
CCDB · book-fedorov — TpociHMOBCKU, 1\ofiLIJIJ[HCmd 1964
CCDB · book-atlas-flowering-plants — Covas 1952
CCDB · kew — Jakob SS, Meister A, Blattner FR. 2004. Considerable genome size variation of Hordeum species (Poaceae) is linked to phylogeny, life form, ecology, and speciation rates. Molecular Biology and Evolution 21: 860-869.
CCDB · Cave1959 — Rajh. & Morris. 1959b
CCDB · Cave1962 — Bowden 1962
2n 143×GoaT · Kew Plant DNA C-values Database · CCDB · kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · kew — Vogel KP, Arumuganathan K, Jensen KB. 1999. Nuclear DNA content of perennial grasses of the Triticeae. Crop Science 39: 661-667.
2n 421×CCDB · kew
CCDB · kew — Jakob SS, Meister A, Blattner FR. 2004. Considerable genome size variation of Hordeum species (Poaceae) is linked to phylogeny, life form, ecology, and speciation rates. Molecular Biology and Evolution 21: 860-869.
n 141×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type4 253 records
Wild obs. + sensor1 047
Museum / vouchered2 444
Cultivated / captive60
Other702
Origin
Native538
Introduced1
Range
Area of Occupancy AOO10 116 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy93% within 1 km
≤100 m 732≤1 km 70≤10 km 21>10 km 44
867 georeferenced · 180 without coordinates
Open the mapobservation + sensor1 047
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 123≤1 km 540≤10 km 421>10 km 31
1 115 georeferenced · 1 329 without coordinates
Open the institutions mapphysical evidence2 444
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy79% within 1 km
≤1 km 44≤10 km 11>10 km 1
56 georeferenced · 4 without coordinates
Open the mapnot free-living60
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 118 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Davis, US | 197 |
| WTUlocation not on record | 130 |
| Bronx, US | 101 |
| Claremont, US | 100 |
| Victoria, CA | 100 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 96 |
| Corvallis, US | 94 |
| Pullman, US | 86 |
| Logan, US | 83 |
| Riverside, US | 69 |
| Vancouver, CA | 59 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 58 |
| Moscow, US | 58 |
| Flagstaff, US | 57 |
| Arcata, US | 52 |
| US | 46 |
| SWE054location not on record | 44 |
| San Luis Obispo, US | 42 |
| Boise, US | 40 |
| Santa Barbara, US | 38 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 38 |
| Denver, US | 37 |
| Albuquerque, US | 32 |
| Pocatello, US | 30 |
| Caldwell, US | 29 |
| Missoula, US | 29 |
| Angwin, US | 29 |
| Canadian Department of Agriculturelocation not on record | 27 |
| ASUlocation not on record | 27 |
| San Diego, US | 24 |
| CASlocation not on record | 20 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 19 |
| Provo, US | 18 |
| Bozeman, US | 16 |
| Anchorage, US | 16 |
| University of Stellenboschlocation not on record | 16 |
| Saint Louis, US | 16 |
| DOI/NPS, Greenbelt Parklocation not on record | 15 |
| Chongqing Museumlocation not on record | 13 |
| Durango, US | 13 |
| Moscow State Universitylocation not on record | 12 |
| Pittsburg, US | 11 |
| San Jose, US | 10 |
| Bend, US | 9 |
| Tacoma, US | 9 |
| Wuzhou, CN | 8 |
| Eastern Nevada Landscape Coalitionlocation not on record | 8 |
| Tampa, US | 8 |
| Fredericton Stock Culture Collectionlocation not on record | 7 |
| Ashland, US | 6 |
| Bloomington, US | 6 |
| Orem, US | 6 |
| Sichuan Agricultural Universitylocation not on record | 6 |
| Santa Cruz, US | 6 |
| Phoenix, US | 6 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 5 |
| University of Alberta Museumslocation not on record | 5 |
| LDlocation not on record | 5 |
| Whitehorse, CA | 5 |
| Chadron, US | 5 |
| Truckee, US | 5 |
| Portland, US | 5 |
| Grand Junction, US | 5 |
| VALElocation not on record | 5 |
| Montréal, CA | 4 |
| Cheney, US | 4 |
| St. Paul, US | 4 |
| Henderson, US | 4 |
| Weber State Universitylocation not on record | 4 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 4 |
| B.A. Bennett Herbariumlocation not on record | 4 |
| Université Lavallocation not on record | 4 |
| Irvine, US | 4 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| USFSlocation not on record | 3 |
| Sanda, JP | 3 |
| Yukon Universitylocation not on record | 3 |
| EL PASO, US | 3 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| IDElocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 2 |
| Bandelier National Monumentlocation not on record | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| San Angelo, US | 2 |
| STNFlocation not on record | 2 |
| Kew, GB | 1 |
| Fort Worth, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| University of Alaska Museum of the Northlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Long Beach, US | 1 |
| Walla Walla, US | 1 |
| Royal British Columbia Museumlocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Burlington, US | 1 |
| Frankfurt am Main | 1 |
| INFlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Los Angeles, US | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Northridge, US | 1 |
| Berlin, DE | 1 |
| Dekalb, US | 1 |
| Helsinki, FI | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Portland, US | 1 |
| Chapel Hill, US | 1 |
| US | 1 |
| Paris, FR | 1 |
| Tuscaloosa, US | 1 |
| KNFHClocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Jackson, US | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
118 institutions · 2 277 of 2 444 vouchered records shown · 164 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA32 detections
Where the DNA of Hordeum brachyantherum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found32
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 32 detections have coordinates
Open the map2 countries0
Sandy ocean beach, below high tide line, wit…Disturbed gravel roadside.Fragments and damaged plants washed up on gr…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.2 °C -4.40–13.7
Seasonal swing summer↔winter18.2 °C
Max temp (day)13.9 °C -1.10–16.5
Min temp (night)8.20 °C -6.50–12.1
Precipitation98.2 mm/mo 54.0–197
Air humidity65.1 % 61.6–67.5
Moisture balance25.3 mm/mo -52.4–250
Vapour deficit446 Pa 269–541
Wind speed4.40 m/s 1.60–5.60
Cloud cover48.1 % 37.0–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.