Hordeum arizonicum

Covas · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Hordeum

At a glance

Occurrence records64

Data sources13

Biological traits11

DNA specimens23

eDNA detections23

Sources13 archives

Databases and archives Hordeum arizonicum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF64 records

Environmental DNA1 datasets · 0 countries23 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceCCDB · GoaT12.1 Gbp

01Narrative

Hordeum arizonicum is a species of wild barley known by the common name Arizona barley. It is native to northern Mexico and the southwestern United States, where it grows in wet spots in desert regions, such as irrigation ditches. It can grow in somewhat saline soils. This is an annual or perennial grass forming erections 20 to 70 cm high. The inflorescence is a spike up to about 12 cm long made up of spikelets up to about 3 cm long each, usually tipped with awns.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessn.d.

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hordeum arizonicum has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes3

GenBank sequences10

eDNA detections23

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY255056.1 ↗217 bp

ACGT

TCGTGACCCTGACCAAAACAGACCGCGCTCGTGTCATCCAATCCGCCGGCGGTGGCACCAACCGTCGCTCGGCCAAGCCCTCGACCACCT …

Hordeum arizonicum internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hordeum arizonicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size12 068 520 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hordeum arizonicum12.07 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidy6× hexaploid · measured

Chromosome records42–422n range42median42mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 427×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Love, A. 1980. In IOPB chromosome number reports LXVI. Taxon 29: 166–169.

CCDB · ipcn-api-dl — Jessop, C. M. & N. C. Subrahmanyam. 1984. Nucleolar number variation in Hordeum species, their haploids and interspecific hybrids. Genetica 64: 93–100.

CCDB · ipcn-api-dl — Baden, C. & R. v. Bothmer. 1994. A taxonomic revision of Hordeum sect. Critesion. Nordic J. Bot. 14(2): 117–136.

CCDB · book-ipcn66 — Rajhathy & Symko 1966

CCDB · kew — Jakob SS, Meister A, Blattner FR. 2004. Considerable genome size variation of Hordeum species (Poaceae) is linked to phylogeny, life form, ecology, and speciation rates. Molecular Biology and Evolution 21: 860-869.

CCDB · Cave1962 — Bowden 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type64 records

Museum / vouchered47

Cultivated / captive7

Other10

Origin

Native9

Range

Area of Occupancy AOO128 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 4≤1 km 7≤10 km 5>10 km 1

17 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence47

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 1 without coordinates

Open the mapnot free-living7

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	11
Flagstaff, US	8
SWE054location not on record	6
Claremont, US	4
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Phoenix, US	2
The University of Arizonalocation not on record	2
San Bernardino, US	1
Bronx, US	1
CASlocation not on record	1
US	1
Logan, US	1
Zapopan, MX	1
Guasave, MX	1
St. Paul, US	1
Durango, MX	1
University of Stellenboschlocation not on record	1

17 institutions · 46 of 47 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA23 detections

Where the DNA of Hordeum arizonicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)