Hoppea dichotoma

Hayne ex Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Gentianaceae/Hoppea

At a glance

Occurrence records33

Data sources13

Biological traits11

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Hoppea dichotoma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources11 traits

Chemical compositionLOTUS · NPASS29 compounds

Occurrence & distributionGBIF33 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Hoppea dichotoma is a plant species in the genus Hoppea. Diffutin is a flavan, a type of flavonoid, found in H. dichotoma.Dichotosin and dichotosinin, two adaptogenic glucosyloxy flavans from Hoppea dichotoma. Shibnath Ghosal, Dinesh K. Jaiswal, Sushil K. Singh and Radhey S. Srivastava, Phytochemistry, Volume 24, Issue 4, 1985, Pages 831-833,

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition29 compounds

Compounds documented for Hoppea dichotoma across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cembrane diterpenoids8

Flavans7

Flavanones2

Plant xanthones1

Ceramides1

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2E,4R,8S,11S,12R)-4,12-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[9.3.1]pentadec-2-en-6-one	present	NPASS
(1S,2E,4S,8S,11R,12S)-4,11-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[10.2.1]pentadec-2-en-6-one	present	NPASS
(1S,2E,4S,8S,11S,12R)-4,12-dihydroxy-4,8,12-trimethyl-1-propan-2-yl-15-oxabicyclo[9.3.1]pentadec-2-en-6-one	present	NPASS
(2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[[(2S)-7-methoxy-2-(4-methoxyphenyl)-3,4-dihydro-2H-chromen-5-yl]oxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5S,6S)-2-(hydroxymethyl)-6-[[(2S)-7-methoxy-2-(4-methoxyphenyl)-3,4-dihydro-2H-chromen-5-yl]oxy]oxane-3,4,5-triol	present	LOTUS
(2S)-2-(3,4-Dimethoxyphenyl)-3,4-dihydro-7-hydroxy-2H-1-benzopyran-5-yl beta-D-glucopyranoside	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(2S)-2-(3,4-dimethoxyphenyl)-7-methoxy-3,4-dihydro-2H-chromen-5-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6S)-2-[[(2S)-2-(3,4-dimethoxyphenyl)-7-hydroxy-3,4-dihydro-2H-chromen-5-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3S,4S,5S,6S)-2-[[(2R)-2-(3,4-dimethoxyphenyl)-7-methoxy-3,4-dihydro-2H-chromen-5-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
3,5-Dimethoxy-1,6-dihydroxyxanthone	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hoppea dichotoma has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAJ388240.1 ↗282 bp

ACGT

TGTCTATATAAAGCAATTGAACACCCATTCAGTTGACTTTATGGGATATGTTGTAAGTGTTCGATTAAGATGTTCAATGGTACGAAGTGA …

Hoppea dichotoma chloroplast partial matK gene (corresponding location in Tobacco: 963-1244)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Hoppea dichotoma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records20–382n range36median36mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1

CCDB · book-ipcn67-71 — MUKHERJEE, B. 1968. Cytotaxonomic studies of some genera of 484 Gentianaceae. Nucleus, Suppl. vol. 1968: 45-48.

CCDB · book-indian_vol1 — Mukherjee, B. 1968

2n 201×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Vasudevan, K.N. 1972

2n 351×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Mallikarjuna, M. B. 1985. Karyomorphological and cytotaxonomic studies in the family Gentianaceae. Ph.D. Thesis, Bangalore University. ý.

2n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Mallikarjuna, M. B., A. SHERIFF & D. G. Krishnappa. 1987. Chromosome Number Reports 97. Taxon 36: 766–767.

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MUKHERJEE, B. 1968. Cytotaxonomic studies of some genera of 484 Gentianaceae. Nucleus, Suppl. vol. 1968: 45-48.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type33 records

Wild obs. + sensor7

Museum / vouchered26

Origin

Native1

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 5 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 18

18 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	18
Zürich, CH	3
South Kensington, GB	2
Kew, GB	1
Dehra Dun, IN	1
Palmerston, AU	1

6 institutions · 26 of 26 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Hoppea dichotoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)