Hoplunnis diomediana

Goode & Bean, 1896 · species

image placeholder — illustration coming later

Animalia/Chordata/Anguilliformes/Nettastomatidae/Hoplunnis

At a glance

Occurrence records110

Data sources9

Biological traits5

DNA specimens8

eDNA detections7

Sources9 archives

Databases and archives Hoplunnis diomediana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

OBISOcean Biodiversity Information System37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS110 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

The blacktail pike-conger (Hoplunnis diomediana) is an eel in the family Nettastomatidae (duckbill/witch eels).Hoplunnis diomediana at www.fishbase.org. It was described by George Brown Goode and Tarleton Hoffman Bean in 1896.Goode, G. B. and T. H. Bean, 1896 (23 Aug.) [ref. 1848] Oceanic ichthyology, a treatise on the deep-sea and pelagic fishes of the world, based chiefly upon the collections made by the steamers Blake, Albatross, and Fish Hawk in the northwestern Atlantic, with an atlas containing 417 figures. Special Bulletin U. S. National Museum No. 2: Text: i–xxxv + 1–26 + 1–553, Atlas: i–xxiii, 1–26, 123 pls. It is a subtropical, marine eel which is known from the western Atlantic Ocean. It is known to dwell at a maximum depth of 203 meters. Males can reach a maximum total length of 36.6 centimeters.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length36.6 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Other traits2

Depth max203 m

Vulnerability26.6

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hoplunnis diomediana has left across the world's sequence archives.

At a glance

DNA specimens8

BINs2

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.05%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

361Cmostly conserved

CCTATACCTAGTTTTCGGTGCTTGAGCCGGCATAGTAGGGACTGCCCTAAGCCTATTAATCCGAGCCGAACTTAGCCAACCAGGGGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hoplunnis sicariussame genus8.3%Hoplunnis macrurasame genus11.3%Nettastoma solitariumsame family15.2%Kryptopterus bicirrhissame order15.3%Pseudophichthys splendenssame order15.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type110 records

Wild obs. + sensor17

Museum / vouchered91

Other2

Origin

Native4

Range

Area of Occupancy AOO284 km²

Depth

0–200 m sunlit20

200–1000 m twilight3

1–4 km midnight0

>4 km abyssal0

median 118 m · max 203.1 m · 23 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 14 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 7≤1 km 3≤10 km 6>10 km 4

20 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
FishBaselocation not on record	10
University of Texas Biodiversity Collections (UTBC)location not on record	8
Cambridge, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
North Carolina Museum of Natural Scienceslocation not on record	6
New Haven, US	4
University of Alabamalocation not on record	2
Mexico City, MX	1
Tapachula, MX	1
Florida Fish and Wildlife Conservation Commission, Fish and Wildlife Research Institutelocation not on record	1
CASlocation not on record	1
Paris, FR	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
Chicago, US	1

16 institutions · 62 of 91 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Hoplunnis diomediana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.8 °C 22.5–25.6

Seasonal swing summer↔winter8.50 °C

Max temp (day)24.7 °C 23.6–26.6

Min temp (night)22.8 °C 21.6–24.8

Precipitation119 mm/mo 55.9–125

Air humidity60.2 % 58.8–61.7

Vapour deficit1,136 Pa 1,106–1,323

Cloud cover33.8 % 30.0–36.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)