Hopea utilis

(Bedd.) Bole · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Hopea

At a glance

Occurrence records82

Data sources8

Biological traits12

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Hopea utilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility82 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources12 traits

Chemical compositionLOTUS · NPASS120 compounds

Occurrence & distributionGBIF82 records

DNA & barcodingNCBIsequences

01Narrative

Hopea utilis is a species of plant in the family Dipterocarpaceae. It is native to Kerala and Tamil Nadu in India.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Plant height20 m

Life cycle & reproduction4

Deciduousnessevergreen

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment3

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density840 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition120 compounds

Compounds documented for Hopea utilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols28

Oligomeric stibenes18

Neolignans7

Flavones6

Flavones $ Flavonolignans5

Documented compounds120 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Cycloolivil	present	NPASS
(+)-Lyoniresinol	present	LOTUS
(-)-Olivil	present	NPASS
(1R,2R)-2-(4-hydroxy-3-methoxyphenoxy)-1-(4-hydroxy-3-methoxyphenyl)propane-1,3-diol	present	NPASS
(1R,2R,3S,9R,10R,17R)-3-[(2R,3R)-3-(3,5-dihydroxyphenyl)-6-hydroxy-2-(4-hydroxyphenyl)-2,3-dihydro-1-benzofuran-4-yl]-2,9,17-tris(4-hydroxyphenyl)-8-oxapentacyclo[8.7.2.04,18.07,19.011,16]nonadeca-4(18),5,7(19),11(16),12,14-hexaene-5,13,15-triol	present	LOTUS
(1R,2S)-1-(4-hydroxy-3,5-dimethoxyphenyl)-2-[4-(3-hydroxypropyl)-2,6-dimethoxyphenoxy]propane-1,3-diol	present	NPASS
(1R,6S,7R,11bR)-1,6,7,11b-Tetrahydro-1,7-bis(4-hydroxyphenyl)benzo[6,7]cyclohepta[1,2,3-cd]benzofuran-4,6,8,10-tetrol	present	LOTUS
(1R,8S,9R,16R)-8,16-bis(4-hydroxyphenyl)-9-[(1R,8S,9R,16R)-4,6,12-trihydroxy-8,16-bis(4-hydroxyphenyl)-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2(7),3,5,10(17),11,13-hexaen-9-yl]-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2(7),3,5,10(17),11,13-hexaene-4,6,12-triol	present	LOTUS
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(1S,8S,9S,16S)-8,16-bis(4-hydroxyphenyl)-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2(7),3,5,10(17),11,13-hexaene-4,6,9,12-tetrol	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hopea utilis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

The DNA barcodea real sequence read deposited for this species

rbcLOK632638.1 ↗646 bp

ACGT

CTTATTATACTCCTCAATACCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACACCTCAACCCGGAGTTCCGCCTGAAGAAG …

Hopea utilis isolate HU1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL5

plant barcode

08Occurrence & distribution

Record type82 records

Wild obs. + sensor7

Museum / vouchered75

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 7

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 46

46 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	57

1 institutions · 57 of 75 vouchered records shown · 18 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)