Hopea parviflora

Bedd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Hopea

At a glance

Occurrence records125

Data sources8

Biological traits14

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Hopea parviflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources14 traits

Chemical compositionLOTUS · NPASS50 compounds

Occurrence & distributionGBIF125 records

DNA & barcodingNCBIsequences

01Narrative

Hopea parviflora is a species of plant in the family Dipterocarpaceae. It is endemic to India. It is called 'kampakam' or 'thampakam' in Malayalam and கோங்கு 'vellaikongu' or 'irubogam' in Tamil. Hopea parviflora is a tree growing 30 – 37 metres tall. The bole can be 150 cm in diameter. The tree produces a beautiful timber and is commonly harvested from the wild, both for local use and for trade. The plant is classified as 'Endangered' in the IUCN Red List of Threatened Species. Flowers of Hopea parviflora with tender leaves. Image from Idayilekkad in Kasargodu, Kerala, India

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology4

Plant height30 m

Seed mass269 mg

Seed mass max400 mg

Seed mass min200 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment3

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density790 mg/cm³

03Chemical composition50 compounds

Compounds documented for Hopea parviflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oligomeric stibenes16

Eudesmane sesquiterpenoids11

Germacrane sesquiterpenoids7

Monomeric stilbenes5

Acyclic monoterpenoids $ Irregular monoterpenoids2

Documented compounds50 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-beta-Sesquiphellandrene	present	NPASS
(+)-Parviflorol	present	LOTUS
(+)-Santolina alcohol	present	NPASS
(-)-Santonin	present	NPASS
(1R,6S,7R,11bR)-1,6,7,11b-Tetrahydro-1,7-bis(4-hydroxyphenyl)benzo[6,7]cyclohepta[1,2,3-cd]benzofuran-4,6,8,10-tetrol	present	LOTUS
(1R,8R,9R,16R)-8,16-bis(4-hydroxyphenyl)-9-[(1R,8R,9R,16R)-4,6,12-trihydroxy-8,16-bis(4-hydroxyphenyl)-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2(7),3,5,10(17),11,13-hexaen-9-yl]-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2(7),3,5,10(17),11,13-hexaene-4,6,12-triol	present	LOTUS
(1R,8R,9S,16R)-9-[(1R,8R,9S,16R)-12-hydroxy-8,16-bis(4-hydroxyphenyl)-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2,4,6,10(17),11,13-hexaen-9-yl]-8,16-bis(4-hydroxyphenyl)-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2,4,6,10(17),11,13-hexaen-12-ol	present	LOTUS
(1S,2R,3R,9S,10S,17S)-2-[(2S,3S)-3-(3,5-dihydroxyphenyl)-6-hydroxy-2-(4-hydroxyphenyl)-2,3-dihydro-1-benzofuran-4-yl]-6-[(1R,2S)-2-[3,5-dihydroxy-2-[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]phenyl]-2-hydroxy-1-(4-hydroxyphenyl)ethyl]-3,9,17-tris(4-hydroxyphenyl)-8-oxapentacyclo[8.7.2.04,18.07,19.011,16]nonadeca-4(18),5,7(19),11(16),12,14-hexaene-5,13,15-triol	present	LOTUS
(2R)-2-[(3S)-3-hydroxy-3-methylpent-4-enyl]-3-methyl-2H-furan-5-one	present	NPASS
(2R,3R,4S,5S,6S)-6-[2,4-dihydroxy-6-[(1S,2S)-1-hydroxy-2-[2-hydroxy-6-[(E)-2-(4-hydroxyphenyl)ethenyl]-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-2-(4-hydroxyphenyl)ethyl]phenyl]-5-(hydroxymethyl)oxane-2,3,4-triol	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hopea parviflora has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

The DNA barcodea real sequence read deposited for this species

rbcLMZ568811.1 ↗626 bp

ACGT

GACTTATTATACTCCTGAATACCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACACCTCAACCCGGAGTTCCGCCTGAAGA …

Hopea parviflora isolate HP4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL5

plant barcode

08Occurrence & distribution

Record type125 records

Wild obs. + sensor103

Museum / vouchered20

Other2

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 79≤1 km 6≤10 km 7>10 km 5

97 georeferenced · 6 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	17
South Kensington, GB	1

2 institutions · 18 of 20 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)