Hopea odorata

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Hopea

At a glance

Occurrence records179

Data sources13

Biological traits19

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Hopea odorata's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility179 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF179 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB623 Mbp

01Narrative

Hopea odorata, or ta-khian (), is a species of plant in the family Dipterocarpaceae. It is found in Bangladesh, Cambodia, India, Laos, Malaysia, Myanmar, Thailand, and Vietnam. It is a large tree reaching up to 45 m in height with the base of the trunk reaching a diameter of 4.5 m. It grows in forests, preferably near rivers, at altitudes between 0 and 600m. In places such as West Bengal and the Andaman Islands it is often planted as a shade tree.AgroForestryTree Database - Species information Valued for its wood, it is a threatened species in its natural habitat.2006 IUCN Red List of Threatened Species Downloaded on 21 August 2007.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height30 m

Seed mass235 mg

Seed mass max266 mg

Seed mass min188 mg

Life cycle & reproduction6

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)15.82 mm²/mg

Wood density712 mg/cm³

03Chemical composition1 compounds

Compounds documented for Hopea odorata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Oligomeric stibenes1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Unii-8K2E6922LC		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hopea odorata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMZ782439.1 ↗5 800 bp

ACGT

TCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGCGAATGGCTCATTAAATCAGTTA …

Hopea odorata voucher BGT4270 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hopea odorata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size623 475 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Hopea odorata0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy3× triploid · measured

Chromosome records14–202n range14median14mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +1

CCDB · book-ipcn66 — Roy & Jha 1965

CCDB · book-ipcn67-71 — JONG, K . & A. LETHBRIDGE. 1967. Cytological studies in the Dipterocarpaceae, I. Chromosome numbers of certain Malaysian genera. Notes Roy. Bot. Gard. Edinburgh 27: 175-184.

CCDB · book-indian_vol1 — Roy, R.P. & Jha, R.P. 1959, 1960a, 1962a, 1965a

CCDB · book-indian_vol1 — Jong, K. & Lethbridge, A. 1967

CCDB · book-fedorov — Roy R. P., Jha 1965a

2n 203×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Tixier, P. 1953

CCDB · book-fedorov — Tixier 1953

CCDB · book-atlas-flowering-plants — Tixier 1953

n 72×CCDB · ipcn-api-dl · CCDB · book-ipcn66

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.

CCDB · book-ipcn66 — Roy & Jha 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

triploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type179 records

Wild obs. + sensor68

Museum / vouchered111

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy18% within 1 km

≤100 m 6≤1 km 2≤10 km 2>10 km 34

44 georeferenced · 24 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 2>10 km 1

4 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence111

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	6
CNF-UFHBlocation not on record	3
Pondicherry, IN	3
Paris, FR	2
Edinburgh, GB	2
National Institute of Biological Resourceslocation not on record	1
Kunming, CN	1
Kew, GB	1
Denver, US	1
Xiamen, CN	1
MeiseBGlocation not on record	1
Saint Louis, US	1
Universität Hannoverlocation not on record	1
University of Stellenboschlocation not on record	1
Servico de Microbiologia e Imunologialocation not on record	1
Bloomington, US	1
South Kensington, GB	1

17 institutions · 28 of 111 vouchered records shown · 81 without an institution code

09Environmental DNA3 detections

Where the DNA of Hopea odorata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 25.2–25.2

Seasonal swing summer↔winter6.00 °C

Max temp (day)29.6 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity63.4 %

Moisture balance21.8 mm/mo

Vapour deficit1,175 Pa

Wind speed3.20 m/s

Cloud cover64.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)