Hopea mengarawan — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Hopea

At a glance

Occurrence records149

Data sources7

Biological traits19

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Hopea mengarawan's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility149 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF149 records

DNA & barcodingNCBIsequences

01Narrative

Hopea mengarawan is a species of flowering plant in the family Dipterocarpaceae. It is found in Indonesia, Malaysia, and Singapore.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height40 m

Seed mass160 mg

Seed mass max160 mg

Seed mass min160 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza type0.159316509

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density562 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hopea mengarawan has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY026708.1 ↗376 bp

ACGT

TTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGTTGAGAGGCCATCCGCACGGACGGCGCATCAGGGGCCGGACGAGCTCCCCA …

Hopea mengarawan internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL3ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type149 records

Wild obs. + sensor12

Museum / vouchered135

Other2

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy30% within 1 km

≤1 km 3>10 km 7

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 135 records without

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	1
Tampa, US	1

2 institutions · 2 of 135 vouchered records shown · 133 without an institution code