Hopea brevipetiolaris

(Thwaites) P.S.Ashton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Dipterocarpaceae/Hopea

At a glance

Occurrence records26

Data sources9

Biological traits7

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Hopea brevipetiolaris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS84 compounds

Occurrence & distributionGBIF26 records

DNA & barcodingNCBIsequences

01Narrative

Hopea brevipetiolaris is a species of plant in the family Dipterocarpaceae. It is endemic to Sri Lanka.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition84 compounds

Compounds documented for Hopea brevipetiolaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Dibenzylbutyrolactone lignans19

Lupane triterpenoids14

Oleanane triterpenoids7

Ursane and Taraxastane triterpenoids6

Simple coumarins6

Documented compounds84 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	NPASS
(-)-(7R,8R,8'R)-acuminatolide	present	NPASS
(-)-Matairesinol	present	NPASS
(1R,2S,9R,10S,17R,18R)-9,17-bis(4-hydroxyphenyl)heptacyclo[16.12.0.02,10.03,8.011,16.019,24.025,30]triaconta-3(8),4,6,11(16),12,14,19(24),20,22,25(30),26,28-dodecaene-5,7,13,15,21,23,27-heptol	present	LOTUS
(1R,3aS,5aR,5bR,7aR,8S,9R,11aS,11bR,12R,13aR,13bR)-3a-[(2S,3R,4S,5S,6R)-6-[[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxymethyl]-3,4,5-trihydroxyoxan-2-yl]oxycarbonyl-9,12-dihydroxy-5a,5b,8,11a-tetramethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-8-carboxylic acid	present	NPASS
(1R,3aS,5S,5aR,5bS,7aS,8S,9R,11aR,11bR,13aS,13bS)-9-hydroxy-5,5b,8,11a-tetramethyl-1-prop-1-en-2-yl-2,3,4,5,5a,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydro-1H-cyclopenta[a]chrysene-3a,8-dicarboxylic acid	present	NPASS
(1R,3aS,5S,5aR,5bS,7aS,8S,9R,11aR,11bS,13aR,13bR)-3a-[(2S,3R,4S,5S,6R)-6-[[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxymethyl]-3,4,5-trihydroxyoxan-2-yl]oxycarbonyl-9-hydroxy-5,5b,8,11a-tetramethyl-1-prop-1-en-2-yl-2,3,4,5,5a,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydro-1H-cyclopenta[a]chrysene-8-carboxylic acid	present	NPASS
(1R,3aS,5S,5aR,5bS,7aS,9R,11aR,11bR,13aR,13bR)-5,5b,8,8,11a-pentamethyl-1-prop-1-en-2-yl-9-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,5,5a,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydro-1H-cyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS
(1S,2R,4aS,6aR,6aS,6bR,8aS,9R,10R,11R,12aR,14bS)-10,11-dihydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	NPASS
(1S,8S,9S,16S)-8,16-bis(4-hydroxyphenyl)-15-oxatetracyclo[8.6.1.02,7.014,17]heptadeca-2(7),3,5,10(17),11,13-hexaene-4,6,9,12-tetrol	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hopea brevipetiolaris has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY026700.1 ↗355 bp

ACGT

TTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGTTGCGAGCGCGGACGGCGCTTCGGGGGTCCTGACGAGCTCCCCACGGGACG …

Hopea brevipetiolaris internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type26 records

Museum / vouchered26

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 26 records without

Open the institutions mapphysical evidence26

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	3
University of Stellenboschlocation not on record	3
Pomona Collegelocation not on record	2
Claremont, US	1

4 institutions · 9 of 26 vouchered records shown · 17 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)