Homoranthus tropicus

Byrnes · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Homoranthus

At a glance

Occurrence records133

Data sources8

Biological traits10

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Homoranthus tropicus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility133 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources10 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF133 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Homoranthus tropicus is a flowering plant in the family Myrtaceae and is endemic to tropical north Queensland. It is a shrub with curved, club-shaped leaves and white flowers in a corymb-like arrangement on the ends of branchlets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Life cycle & reproduction4

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition2 compounds

Compounds documented for Homoranthus tropicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cinnamic acids and derivatives1

Wax monoesters1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
1-Methoxy-4-(2-propenyl)benzene		present	LOTUS
Hex-trans-3-enyl butyrate		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Homoranthus tropicus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKAY525133.2 ↗2 502 bp

ACGT

GCTAGCATCTTTTTCATATTTATATGAAGTAACGGATTCGTTCATATCTTCGGTAGAGTTTGTAAGACAACGACTGATCCTGAAAGGAAT …

Homoranthus tropicus trnK gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type133 records

Wild obs. + sensor2

Museum / vouchered129

Other2

Origin

Native19

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 53≤1 km 18≤10 km 38

109 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	43
Smithfield, AU	22
Museo Entomologico de Leonlocation not on record	14
Mount Annan, AU	13
Palmerston, AU	11
Canberra, AU	10
Kew, GB	5
Armidale, AU	4
Kensington, AU	2
James Cook Townsvillelocation not on record	1
Beijing, CN	1
Adelaide, AU	1

12 institutions · 127 of 129 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Homoranthus tropicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)