Homalium ceylanicum

(Gardner) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Salicaceae/Homalium

At a glance

Occurrence records18

Data sources7

Biological traits16

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Homalium ceylanicum's data was compiled from.

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 20

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height25 m

⚠ sources differ — GIFT: 25 m · TRY: 30 m

Plant height max40 m

Plant height min6 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density680 mg/cm³

⚠ sources differ — TRY: 680 mg/cm³ · GIFT: 830 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Homalium ceylanicum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW044394.1 ↗217 bpChina · 2017

ACGT

GTTGGCCCGAAATCGAGCCATGGGCGACGGTCGCCACGACAAGCGGTGGTTGAGAGACCCTCGAAAGCGGTCGTGCGCGCCCCGTCGCCC …

Homalium ceylanicum voucher HJL4402 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Homalium ceylanicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Krishnan, N. 1977. Cytotaxonomical studies on Bixaceae and Samydaceae from south India with collected evidences from palynology, anatomy and biochemistry. Ph.D. Thesis, Annamalai University. 156 pp.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type18 records

Wild obs. + sensor2

Museum / vouchered16

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	10
Chengdu, CN	1
Kew, GB	1
Guilin, CN	1
Cincinnati, US	1
Herbarium of South China Botanical Gardenlocation not on record	1
University of Stellenboschlocation not on record	1

7 institutions · 16 of 16 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Homalium ceylanicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 17.4–17.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)21.6 °C

Min temp (night)12.2 °C

Precipitation178 mm/mo

Air humidity65.7 %

Moisture balance78.2 mm/mo

Vapour deficit677 Pa

Wind speed1.80 m/s

Cloud cover43.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)