Holothuria fuscopunctata

Jaeger, 1833 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Holothuriida/Holothuriidae/Holothuria

At a glance

Occurrence records772

Data sources6

Biological traits2

DNA specimens11

eDNA detections8

Sources6 archives

Databases and archives Holothuria fuscopunctata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility772 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF772 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD11 specimens

01Narrative

L’holothurie trompe d'éléphant est une espèce de concombres de mer de la famille des Holothuriidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Holothuria fuscopunctata has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes1

eDNA detections8

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P671 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

2Amostly conserved

5Gvariable

17Gmostly conserved

111Cvariable

143Cvariable

248Tmostly conserved

326Cmostly conserved

338Tmostly conserved

461Tmostly conserved

494Tmostly conserved

539Avariable

578Tmostly conserved

GAGGGTTTGGCAAATGGCTCATTCCCCTGATGATAGGAGCCCCAGACATGGCCTTCCCCCGGATGAAAAAAATGAGTTTCTGACTAGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes3

BIN1

Most divergent pair0.60%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudocolochirus violaceussame order16.2%Thelenota ananassame order16.7%Bohadschia koellikerisame family17.1%Phyllophorella kohkutiensissame order17.2%Plesiocolochirus challengerisame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type772 records

Wild obs. + sensor741

Museum / vouchered29

Other2

Range

Area of Occupancy AOO1 340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 187≤1 km 191≤10 km 34>10 km 22

434 georeferenced · 307 without coordinates

Open the mapobservation + sensor741

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 5≤1 km 3≤10 km 1

9 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	14
Sydney, AU	12
Cambridge, US	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 29 of 29 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Holothuria fuscopunctata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 27.2–27.2

Seasonal swing summer↔winter3.80 °C

Max temp (day)27.9 °C

Min temp (night)26.2 °C

Precipitation307 mm/mo

Air humidity65.5 %

Vapour deficit1,236 Pa

Cloud cover75.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)