Holothuria flavomaculata

Semper, 1868 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Holothuriida/Holothuriidae/Holothuria

At a glance

Occurrence records327

Data sources9

Biological traits6

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Holothuria flavomaculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility192 records↗

OBISOcean Biodiversity Information System135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS327 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Holothuria (Semperothuria) flavomaculata, also known as the red snakefish, is a species of sea cucumber in the family Holothuriidae. The cucumber is found in the Red Sea, Indian Ocean, and the South Pacific. A study of the species in 2008 collected specimens at a depth of 6 to 14 meters.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length55 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits3

Depth max40 m

Depth min0 m

Vulnerability42

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Holothuria flavomaculata has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.41%

Haplotypes2

BIN1

Most divergent pair0.76%

Where individuals differ — all 5 variable positions, in barcode order

23Gvariable

295Gvariable

391Tvariable

541Cvariable

613Tvariable

AACTCTCTATCTAATTTTCGGAGCATGAGCAGGTATGGTCGGAACAGCCATGAGTGTTATTATCCGCACCGAACTAGCTCAACCCGGCTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Holothuria hillasame genus14.9%Holothuria spiniferasame genus15.2%Holothuria arenicolasame genus15.3%Holothuria impatienssame genus15.8%Holothuria parvasame genus15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type327 records

Wild obs. + sensor214

Museum / vouchered110

Other3

Range

Area of Occupancy AOO412 km²

Depth

0–200 m sunlit37

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4 m · max 24 m · 37 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 123≤1 km 21≤10 km 5>10 km 4

153 georeferenced · 61 without coordinates

Open the mapobservation + sensor214

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 1≤1 km 10≤10 km 2

13 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	30
Washington, US	11
Brussels, BE	4
RBINS-Scientific Heritagelocation not on record	3
CASlocation not on record	2
Universidad El Bosque (El Bosque)location not on record	1
Cambridge, US	1
Paris, FR	1
University of Floridalocation not on record	1
Museums Victorialocation not on record	1
Royal Museum for Central Africalocation not on record	1
Sydney, AU	1

12 institutions · 57 of 110 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Holothuria flavomaculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

patch reefsand flat and fringing reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 20.1–23.8

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C 22.7–25.3

Min temp (night)22.4 °C 18.1–22.7

Precipitation82.8 mm/mo 50.7–90.5

Air humidity60.0 % 59.7–71.8

Vapour deficit1,166 Pa 663–1,181

Cloud cover33.5 % 31.1–33.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)